Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_PRO-seq_1 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-34c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/
  • Pipeline started at: (06-15 07:17:16) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_PRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz

File_mb 2469.73 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz (261655)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 261655; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz (261657)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.0GB.
PID: 261657; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1.fastq (261662)


Command completed. Elapsed time: 0:02:40. Running peak memory: 0.002GB.
PID: 261662; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2.fastq (41970)


Command completed. Elapsed time: 0:01:34. Running peak memory: 0.002GB.
PID: 41970; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 97729860 PEPPRO RES

Fastq_reads 97729860 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz']

FASTQ processing: (06-15 07:23:33) elapsed: 376.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R1_cutadapt.txt (233666)


Command completed. Elapsed time: 0:01:19. Running peak memory: 3.252GB.
PID: 233666; Command: cutadapt; Return code: 0; Memory used: 3.252GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (233763,233764)


Command completed. Elapsed time: 0:01:10. Running peak memory: 3.252GB.
PID: 233763; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 233764; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 30221343 PEPPRO RES

Trim_loss_rate 69.08 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (234065)


Got SIGTERM. Failing gracefully... (06-15 12:57:44) elapsed: 20051.0 TIME
Child process 234065 (fastqc) terminated after 0 sec.
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/recover.lock.fastq__H9_PRO-seq_1_R1_processed.fastq
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/recover.lock.trimmed_fastqc

Pipeline failed at: (06-15 12:57:44) elapsed: 0.0 TIME

Total time: 5:40:29 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_PRO-seq_1 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-12c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/
  • Pipeline started at: (06-15 12:59:45) elapsed: 36.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_PRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep1_PE2.fastq.gz

File_mb 2469.73 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1.fastq
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/H9_PRO-seq_1_R2.fastq.gz']

FASTQ processing: (06-15 12:59:46) elapsed: 0.0 TIME

cutadapt --version Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/lock.fastq__H9_PRO-seq_1_R1_processed.fastq Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R1_cutadapt.txt (14926)


Command completed. Elapsed time: 0:00:59. Running peak memory: 3.258GB.
PID: 14926; Command: cutadapt; Return code: 0; Memory used: 3.258GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (15390,15391)


Command completed. Elapsed time: 0:00:33. Running peak memory: 3.258GB.
PID: 15390; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 15391; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 30221343 PEPPRO RES

Trim_loss_rate 69.08 PEPPRO RES Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/lock.trimmed_fastqc Overwriting target... Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (15447)

Started analysis of H9_PRO-seq_1_R1_processed.fastq
Approx 5% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 10% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 15% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 20% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 25% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 30% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 35% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 40% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 45% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 50% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 55% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 60% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 65% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 70% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 75% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 80% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 85% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 90% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 95% complete for H9_PRO-seq_1_R1_processed.fastq
Analysis complete for H9_PRO-seq_1_R1_processed.fastq
Command completed. Elapsed time: 0:00:57. Running peak memory: 3.258GB.
PID: 15447; Command: fastqc; Return code: 0; Memory used: 0.182GB

FastQC report r1 fastqc/H9_PRO-seq_1_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq (15527)

[INFO] 3516802 duplicated records removed
Command completed. Elapsed time: 0:00:56. Running peak memory: 3.258GB.
PID: 15527; Command: seqkit; Return code: 0; Memory used: 2.002GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq (15609,15610)


Command completed. Elapsed time: 0:00:24. Running peak memory: 3.258GB.
PID: 15609; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 15610; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 34822522.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 17998987.0 PEPPRO RES

Duplicate_reads 3516802.0 PEPPRO RES

Pct_uninformative_adapter_reads 36.8342 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/processed_R1.flag (15713)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.258GB.
PID: 15713; Command: touch; Return code: 0; Memory used: 0.0GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_R2_cutadapt.txt (15715)


Command completed. Elapsed time: 0:00:54. Running peak memory: 3.432GB.
PID: 15715; Command: cutadapt; Return code: 0; Memory used: 3.432GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq (15801,15802)


Command completed. Elapsed time: 0:00:26. Running peak memory: 3.432GB.
PID: 15801; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 15802; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 60442686 PEPPRO RES

Trim_loss_rate 38.15 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (16066)

Started analysis of H9_PRO-seq_1_R1_processed.fastq
Approx 5% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 10% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 15% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 20% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 25% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 30% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 35% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 40% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 45% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 50% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 55% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 60% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 65% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 70% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 75% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 80% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 85% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 90% complete for H9_PRO-seq_1_R1_processed.fastq
Approx 95% complete for H9_PRO-seq_1_R1_processed.fastq
Analysis complete for H9_PRO-seq_1_R1_processed.fastq

A fatal error has been detected by the Java Runtime Environment:

SIGSEGV (0xb) at pc=0x00007f999e503631, pid=16066, tid=0x00007f9983bfb700

JRE version: Java(TM) SE Runtime Environment (8.0_171-b11) (build 1.8.0_171-b11)

Java VM: Java HotSpot(TM) 64-Bit Server VM (25.171-b11 mixed mode linux-amd64 compressed oops)

Problematic frame:

V [libjvm.so+0x4b3631] CompileBroker::invoke_compiler_on_method(CompileTask*)+0x5a1

Core dump written. Default location: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/core or core.16066

An error report file with more information is saved as:

/sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/hs_err_pid16066.log

If you would like to submit a bug report, please visit:

http://bugreport.java.com/bugreport/crash.jsp

Command completed. Elapsed time: 0:00:58. Running peak memory: 3.432GB.
PID: 16066; Command: fastqc; Return code: -6; Memory used: 0.18GB

Subprocess returned nonzero result. Check above output for details ERROR: Subprocess returned nonzero result, but pipeline is continuing because nofail=True

FastQC report r1 fastqc/H9_PRO-seq_1_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq (16137)

Started analysis of H9_PRO-seq_1_R2_trimmed.fastq
Approx 5% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 10% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 15% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 20% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 25% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 30% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 35% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 40% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 45% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 50% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 55% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 60% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 65% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 70% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 75% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 80% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 85% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 90% complete for H9_PRO-seq_1_R2_trimmed.fastq
Approx 95% complete for H9_PRO-seq_1_R2_trimmed.fastq
Analysis complete for H9_PRO-seq_1_R2_trimmed.fastq
Command completed. Elapsed time: 0:00:54. Running peak memory: 3.432GB.
PID: 16137; Command: fastqc; Return code: 0; Memory used: 0.17GB

FastQC report r2 fastqc/H9_PRO-seq_1_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.histogram

fastq_pair -t 87956874 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq (16204)

Left paired: 30692275       Right paired: 30692275
Left single: 173668     Right single: 1557501
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:02:42. Running peak memory: 6.12GB.
PID: 16204; Command: fastq_pair; Return code: 0; Memory used: 6.12GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_noadap.fastq.paired.fq -o H9_PRO-seq_1 -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt (16448)


Command completed. Elapsed time: 0:00:59. Running peak memory: 6.12GB.
PID: 16448; Command: flash; Return code: 0; Memory used: 0.094GB

Plot adapter insertion distribution (06-15 13:10:55) elapsed: 669.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt -u 8 (16944)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.12GB.
PID: 16944; Command: Rscript; Return code: 0; Memory used: 0.311GB

Adapter insertion distribution cutadapt/H9_PRO-seq_1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/H9_PRO-seq_1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 20 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 13:11:00) elapsed: 5.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/cutadapt/H9_PRO-seq_1.hist

Degradation_ratio 0.8896 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq (16973)


Command completed. Elapsed time: 0:00:21. Running peak memory: 6.12GB.
PID: 16973; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/processed_R2.flag (17341)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.12GB.
PID: 17341; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/repaired.flag

fastq_pair -t 87956874 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq (17348)

Left paired: 30003416       Right paired: 30003416
Left single: 217927     Right single: 1602455
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:02:32. Running peak memory: 6.178GB.
PID: 17348; Command: fastq_pair; Return code: 0; Memory used: 6.178GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq (17984)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 17984; Command: mv; Return code: 0; Memory used: 0.002GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq (17986)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 17986; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/repaired.flag (17988)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 17988; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/dups_repaired.flag

fastq_pair -t 87956874 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq (17989)

Left paired: 26674489       Right paired: 26674489
Left single: 126830     Right single: 4931382
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:01:59. Running peak memory: 6.178GB.
PID: 17989; Command: fastq_pair; Return code: 0; Memory used: 6.154GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq (19059)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 19059; Command: mv; Return code: 0; Memory used: 0.002GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq (19060)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 19060; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/dups_repaired.flag (19063)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 19063; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 13:15:55) elapsed: 295.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 13:15:55) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_bt2 (19064)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 19064; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq (19065)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_PRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 30003416 reads; of these: 30003416 (100.00%) were unpaired; of these: 27299076 (90.99%) aligned 0 times 2704340 (9.01%) aligned exactly 1 time 0 (0.00%) aligned >1 times 9.01% overall alignment rate

Aligned_reads_human_rDNA 5408680.0 PEPPRO RES

Alignment_rate_human_rDNA 8.95 PEPPRO RES

Map to human_rDNA (06-15 13:19:19) elapsed: 204.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_dups_bt2 (19503)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 19503; Command: mkfifo; Return code: 0; Memory used: 0.002GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_dups_R2.fq (19504)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_PRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/fastq/H9_PRO-seq_1_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 2704340 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 13:22:29) elapsed: 189.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_PRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/tmp909od977 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam (20319,20320,20321)

2176982 reads skipped
0 reads lost
27299076 reads; of these:
  27299076 (100.00%) were paired; of these:
    9566070 (35.04%) aligned concordantly 0 times
    14769056 (54.10%) aligned concordantly exactly 1 time
    2963950 (10.86%) aligned concordantly >1 times
    ----
    9566070 pairs aligned concordantly 0 times; of these:
      2129010 (22.26%) aligned discordantly 1 time
    ----
    7437060 pairs aligned 0 times concordantly or discordantly; of these:
      14874120 mates make up the pairs; of these:
        6258301 (42.08%) aligned 0 times
        3282618 (22.07%) aligned exactly 1 time
        5333201 (35.86%) aligned >1 times
88.54% overall alignment rate
[bam_sort_core] merging from 15 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:46:17. Running peak memory: 6.178GB.
PID: 20320; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 20319; Command: bowtie2; Return code: 0; Memory used: 3.802GB
PID: 20321; Command: samtools; Return code: 0; Memory used: 0.897GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam (24875)


Command completed. Elapsed time: 0:01:24. Running peak memory: 6.178GB.
PID: 24875; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 48339851 PEPPRO RES

QC_filtered_reads 27585022 PEPPRO RES

Aligned_reads 20754829.0 PEPPRO RES

Alignment_rate 34.34 PEPPRO RES

Total_efficiency 21.24 PEPPRO RES

Read_depth 3.26 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_PRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/tmp909od977 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp_dups.bam (26249,26255,26256)

24497507 reads; of these:
  24497507 (100.00%) were paired; of these:
    8334941 (34.02%) aligned concordantly 0 times
    13482466 (55.04%) aligned concordantly exactly 1 time
    2680100 (10.94%) aligned concordantly >1 times
    ----
    8334941 pairs aligned concordantly 0 times; of these:
      1950931 (23.41%) aligned discordantly 1 time
    ----
    6384010 pairs aligned 0 times concordantly or discordantly; of these:
      12768020 mates make up the pairs; of these:
        5376104 (42.11%) aligned 0 times
        3000379 (23.50%) aligned exactly 1 time
        4391537 (34.39%) aligned >1 times
89.03% overall alignment rate
[bam_sort_core] merging from 14 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:41:14. Running peak memory: 6.178GB.
PID: 26249; Command: bowtie2; Return code: 0; Memory used: 3.767GB
PID: 26255; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 26256; Command: samtools; Return code: 0; Memory used: 0.897GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam (30214)


Command completed. Elapsed time: 0:01:17. Running peak memory: 6.178GB.
PID: 30214; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 15:05:53) elapsed: 6204.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R2.fq (30427)


Command completed. Elapsed time: 0:00:21. Running peak memory: 6.178GB.
PID: 30427; Command: pigz; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/prealignments/H9_PRO-seq_1_human_rDNA_unmap_R1.fq (30459)


Command completed. Elapsed time: 0:00:25. Running peak memory: 6.178GB.
PID: 30459; Command: pigz; Return code: 0; Memory used: 0.009GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam (30497)


Command completed. Elapsed time: 0:00:38. Running peak memory: 6.178GB.
PID: 30497; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 674956 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam (30537)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.178GB.
PID: 30537; Command: samtools; Return code: 0; Memory used: 0.012GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/chr_sizes.bed (30565,30566,30567,30568)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 30565; Command: samtools; Return code: 0; Memory used: 0.003GB
PID: 30567; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 30566; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 30568; Command: grep; Return code: 0; Memory used: 0.003GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_noMT.bam (30570)


Command completed. Elapsed time: 0:00:41. Running peak memory: 6.178GB.
PID: 30570; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam (30622)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 30622; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam (30623)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.178GB.
PID: 30623; Command: samtools; Return code: 0; Memory used: 0.011GB

Split BAM file (06-15 15:08:57) elapsed: 184.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam (30649,30650)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:46. Running peak memory: 6.178GB.
PID: 30649; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 30650; Command: samtools; Return code: 0; Memory used: 5.83GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE2.bam (31033,31034)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:27. Running peak memory: 6.178GB.
PID: 31034; Command: samtools; Return code: 0; Memory used: 4.57GB
PID: 31033; Command: samtools; Return code: 0; Memory used: 0.004GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp_dups.bam (31393)


Command completed. Elapsed time: 0:00:33. Running peak memory: 6.178GB.
PID: 31393; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE1.bam (31436,31437)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:43. Running peak memory: 6.178GB.
PID: 31436; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 31437; Command: samtools; Return code: 0; Memory used: 5.399GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE2.bam (31655,31656)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:22. Running peak memory: 6.178GB.
PID: 31656; Command: samtools; Return code: 0; Memory used: 4.278GB
PID: 31655; Command: samtools; Return code: 0; Memory used: 0.004GB

Calculate library complexity (06-15 15:20:47) elapsed: 710.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE1.bam (32034)

BAM_INPUT
TOTAL READS     = 20330230
COUNTS_SUM      = 20330230
DISTINCT READS  = 1.66542e+07
DISTINCT COUNTS = 262
MAX COUNT       = 16193
COUNTS OF 1     = 1.47277e+07
OBSERVED COUNTS (16194)
1   14727710
2   1349104
3   301309
4   112637
5   55354
6   31165
7   18956
8   12770
9   8912
10  6479
11  4906
12  3639
13  2910
14  2335
15  1909
16  1594
17  1295
18  1055
19  904
20  791
21  668
22  611
23  529
24  477
25  427
26  388
27  364
28  323
29  242
30  234
31  263
32  232
33  207
34  182
35  165
36  158
37  167
38  119
39  133
40  114
41  111
42  122
43  105
44  82
45  73
46  82
47  75
48  75
49  76
50  60
51  49
52  59
53  63
54  55
55  46
56  48
57  54
58  37
59  41
60  42
61  47
62  48
63  35
64  35
65  32
66  27
67  30
68  32
69  27
70  18
71  21
72  23
73  16
74  16
75  21
76  17
77  15
78  13
79  24
80  11
81  16
82  21
83  21
84  11
85  11
86  10
87  23
88  12
89  16
90  16
91  11
92  12
93  10
94  8
95  9
96  12
97  16
98  6
99  14
100 3
101 5
102 7
103 9
104 5
105 11
106 10
107 7
108 5
109 7
110 7
111 7
112 4
113 7
114 3
115 4
116 11
117 9
118 4
119 5
122 7
123 3
124 3
125 8
126 3
127 4
128 4
129 3
130 3
131 7
132 6
133 4
134 4
135 7
136 7
137 2
138 5
139 4
140 3
141 1
142 4
143 4
144 2
145 3
146 4
147 5
148 2
149 4
150 1
151 1
152 1
154 1
155 5
156 3
158 1
161 1
162 3
163 2
164 1
165 3
166 3
167 1
169 1
170 2
171 1
172 1
173 2
174 1
175 1
176 3
178 2
179 4
181 1
182 1
183 1
184 1
186 1
187 2
188 1
190 1
192 2
193 1
196 1
198 1
199 1
200 1
202 1
203 2
204 2
205 1
206 1
207 1
208 1
209 1
212 1
214 1
216 3
220 1
221 1
222 1
223 1
224 2
227 1
228 1
232 1
233 1
235 1
237 2
241 1
249 1
251 1
253 1
254 1
255 1
256 1
257 1
258 2
262 1
264 1
266 1
268 1
269 1
275 1
277 1
280 1
296 1
299 1
303 1
306 1
313 1
315 1
317 2
325 1
345 1
348 1
406 1
412 1
430 1
433 1
436 1
437 1
493 1
494 1
540 1
547 1
606 2
611 1
612 1
734 1
787 1
789 1
848 1
927 1
943 1
1376    1
1390    1
1414    1
2008    1
4768    1
5683    1
6998    1
14724   1
16193   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 sample size: 19000000 sample size: 20000000 Command completed. Elapsed time: 0:01:41. Running peak memory: 6.178GB.
PID: 32034; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE1.bam (32142)

BAM_INPUT
TOTAL READS     = 20330230
DISTINCT READS  = 1.66542e+07
DISTINCT COUNTS = 262
MAX COUNT       = 16193
COUNTS OF 1     = 1.47277e+07
MAX TERMS       = 100
OBSERVED COUNTS (16194)
1   14727710
2   1349104
3   301309
4   112637
5   55354
6   31165
7   18956
8   12770
9   8912
10  6479
11  4906
12  3639
13  2910
14  2335
15  1909
16  1594
17  1295
18  1055
19  904
20  791
21  668
22  611
23  529
24  477
25  427
26  388
27  364
28  323
29  242
30  234
31  263
32  232
33  207
34  182
35  165
36  158
37  167
38  119
39  133
40  114
41  111
42  122
43  105
44  82
45  73
46  82
47  75
48  75
49  76
50  60
51  49
52  59
53  63
54  55
55  46
56  48
57  54
58  37
59  41
60  42
61  47
62  48
63  35
64  35
65  32
66  27
67  30
68  32
69  27
70  18
71  21
72  23
73  16
74  16
75  21
76  17
77  15
78  13
79  24
80  11
81  16
82  21
83  21
84  11
85  11
86  10
87  23
88  12
89  16
90  16
91  11
92  12
93  10
94  8
95  9
96  12
97  16
98  6
99  14
100 3
101 5
102 7
103 9
104 5
105 11
106 10
107 7
108 5
109 7
110 7
111 7
112 4
113 7
114 3
115 4
116 11
117 9
118 4
119 5
122 7
123 3
124 3
125 8
126 3
127 4
128 4
129 3
130 3
131 7
132 6
133 4
134 4
135 7
136 7
137 2
138 5
139 4
140 3
141 1
142 4
143 4
144 2
145 3
146 4
147 5
148 2
149 4
150 1
151 1
152 1
154 1
155 5
156 3
158 1
161 1
162 3
163 2
164 1
165 3
166 3
167 1
169 1
170 2
171 1
172 1
173 2
174 1
175 1
176 3
178 2
179 4
181 1
182 1
183 1
184 1
186 1
187 2
188 1
190 1
192 2
193 1
196 1
198 1
199 1
200 1
202 1
203 2
204 2
205 1
206 1
207 1
208 1
209 1
212 1
214 1
216 3
220 1
221 1
222 1
223 1
224 2
227 1
228 1
232 1
233 1
235 1
237 2
241 1
249 1
251 1
253 1
254 1
255 1
256 1
257 1
258 2
262 1
264 1
266 1
268 1
269 1
275 1
277 1
280 1
296 1
299 1
303 1
306 1
313 1
315 1
317 2
325 1
345 1
348 1
406 1
412 1
430 1
433 1
436 1
437 1
493 1
494 1
540 1
547 1
606 2
611 1
612 1
734 1
787 1
789 1
848 1
927 1
943 1
1376    1
1390    1
1414    1
2008    1
4768    1
5683    1
6998    1
14724   1
16193   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] .................................................................................................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:47. Running peak memory: 6.178GB.
PID: 32142; Command: preseq; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_counts.txt (32237)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.178GB.
PID: 32237; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_plot (32272)

Processing H9_PRO-seq_1
INFO: Found real counts for H9_PRO-seq_1 - Total (M): 21.966708 Unique (M): 20.33023

Library complexity plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.178GB.
PID: 32272; Command: Rscript; Return code: 0; Memory used: 0.211GB

Library complexity QC_hg38/H9_PRO-seq_1_preseq_plot.pdf Library complexity QC_hg38/H9_PRO-seq_1_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.8774 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 15:24:50) elapsed: 243.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam (32292)


Command completed. Elapsed time: 0:00:18. Running peak memory: 6.178GB.
PID: 32292; Command: samtools; Return code: 0; Memory used: 0.014GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_bamQC.tsv (32424)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/tmp_H9_PRO-seq_1_PE1_b_xgcpnk'
Processing with 12 cores...
Discarding 96 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr9_KI270720v1_random', 'chr14_KI270724v1_random', 'chr22_KI270735v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270590v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1']
Keeping 99 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270539v1', 'chrUn_KI270587v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270584v1', 'chrUn_KI270593v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:24. Running peak memory: 6.178GB.
PID: 32424; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.899GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 10983354.0 PEPPRO RES

PBC2 10983354.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_unmap.bam (32480)


Command completed. Elapsed time: 0:00:09. Running peak memory: 6.178GB.
PID: 32480; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_temp.bam

Unmapped_reads 6258301 PEPPRO RES

Split BAM by strand (06-15 15:25:48) elapsed: 58.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam (32525)


Command completed. Elapsed time: 0:01:10. Running peak memory: 6.178GB.
PID: 32525; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam (32589)


Command completed. Elapsed time: 0:01:08. Running peak memory: 6.178GB.
PID: 32589; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 15:28:07) elapsed: 139.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (32652)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32652; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_plus_TssEnrichment.txt (32653)


Command completed. Elapsed time: 0:00:07. Running peak memory: 6.178GB.
PID: 32653; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.793GB

TSS_coding_score 26.7 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_minus_TssEnrichment.txt (32686)


Command completed. Elapsed time: 0:00:06. Running peak memory: 6.178GB.
PID: 32686; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.925GB

TSS_non-coding_score 10.1 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_minus_TssEnrichment.txt (32721)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.178GB.
PID: 32721; Command: Rscript; Return code: 0; Memory used: 0.317GB

TSS enrichment QC_hg38/H9_PRO-seq_1_TSSenrichment.pdf TSS enrichment QC_hg38/H9_PRO-seq_1_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt (32742,32743,32744,32745)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32742; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 32744; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 32743; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 32745; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt (32747)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32747; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-15 15:28:26) elapsed: 19.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed (32750,32751)


Command completed. Elapsed time: 0:00:02. Running peak memory: 6.178GB.
PID: 32750; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 32751; Command: bedtools; Return code: 0; Memory used: 0.046GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed (32755,32756)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32755; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 32756; Command: bedtools; Return code: 0; Memory used: 0.022GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_TSS_density.bed (32758,32759,32760,32761)


Command completed. Elapsed time: 0:00:27. Running peak memory: 6.178GB.
PID: 32759; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 32761; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 32758; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 32760; Command: sort; Return code: 0; Memory used: 0.004GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_gene_body_density.bed (32785,32786,32787)


Command completed. Elapsed time: 0:00:31. Running peak memory: 6.178GB.
PID: 32786; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 32785; Command: bedtools; Return code: 0; Memory used: 0.063GB
PID: 32787; Command: sort; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/tmp6bum7qxi (32822,32823,32824)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32822; Command: join; Return code: 0; Memory used: 0.001GB
PID: 32824; Command: env; Return code: 0; Memory used: 0.004GB
PID: 32823; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/tmp6bum7qxi | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0210697) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/tmp6bum7qxi > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed (32831)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32831; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 26.45 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed (32836)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.178GB.
PID: 32836; Command: Rscript; Return code: 0; Memory used: 0.317GB

Pause index QC_hg38/H9_PRO-seq_1_pause_index.pdf Pause index QC_hg38/H9_PRO-seq_1_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_pause_index.bed (32857)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 32857; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 15:29:32) elapsed: 65.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam 20754829.0 7959339

Plus_FRiP 0.38 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam 20754829.0 7448642

Minus_FRiP 0.36 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_gene_sort.bed (33122,33123)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33122; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 33123; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_gene_coverage.bed (33126)


Command completed. Elapsed time: 0:00:31. Running peak memory: 6.178GB.
PID: 33126; Command: bedtools; Return code: 0; Memory used: 0.069GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed.gz (33158)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33158; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed (33159)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33159; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 15:30:43) elapsed: 71.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/raw/hg38_annotations.bed (33168)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33168; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer_sort.bed (33170,33171,33172,33173)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33170; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33171; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 33173; Command: bedtools; Return code: 0; Memory used: 0.044GB
PID: 33172; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_plus_coverage.bed (33175)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33175; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_minus_coverage.bed (33193)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33193; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_sort.bed (33209,33210,33211,33212)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33209; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33210; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 33212; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 33211; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_plus_coverage.bed (33214)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.178GB.
PID: 33214; Command: bedtools; Return code: 0; Memory used: 0.024GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_minus_coverage.bed (33234)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33234; Command: bedtools; Return code: 0; Memory used: 0.017GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region" (33251)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33251; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed (33252,33253,33254,33255)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33252; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33254; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 33253; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 33255; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed (33257)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.178GB.
PID: 33257; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed (33271)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33271; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR" (33286)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33286; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR_sort.bed (33287,33288,33289,33290)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33287; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33288; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 33290; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 33289; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_plus_coverage.bed (33292)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33292; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_minus_coverage.bed (33309)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33309; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR" (33326)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33326; Command: mv; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR_sort.bed (33327,33328,33329,33330)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33327; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33328; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 33330; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 33329; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_plus_coverage.bed (33333)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33333; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_minus_coverage.bed (33349)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.178GB.
PID: 33349; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon_sort.bed (33364,33365,33366,33367)


Command completed. Elapsed time: 0:00:03. Running peak memory: 6.178GB.
PID: 33364; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33365; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 33367; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 33366; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_plus_coverage.bed (33373)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.178GB.
PID: 33373; Command: bedtools; Return code: 0; Memory used: 0.025GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_minus_coverage.bed (33390)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.178GB.
PID: 33390; Command: bedtools; Return code: 0; Memory used: 0.022GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron_sort.bed (33408,33409,33410,33411)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33408; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 33410; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 33409; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 33411; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_plus_coverage.bed (33415)


Command completed. Elapsed time: 0:00:16. Running peak memory: 6.178GB.
PID: 33415; Command: bedtools; Return code: 0; Memory used: 0.056GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_minus_coverage.bed (33468)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.178GB.
PID: 33468; Command: bedtools; Return code: 0; Memory used: 0.039GB

Plot cFRiF/FRiF (06-15 15:34:04) elapsed: 201.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_PRO-seq_1 -z 3099922541 -n 11202246 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_plus_coverage.bed (33502)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:33. Running peak memory: 6.178GB.
PID: 33502; Command: Rscript; Return code: 0; Memory used: 0.501GB

cFRiF QC_hg38/H9_PRO-seq_1_cFRiF.pdf cFRiF QC_hg38/H9_PRO-seq_1_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_PRO-seq_1 -z 3099922541 -n 11202246 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_Intron_plus_coverage.bed (33548)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:24. Running peak memory: 6.178GB.
PID: 33548; Command: Rscript; Return code: 0; Memory used: 0.501GB

FRiF QC_hg38/H9_PRO-seq_1_FRiF.pdf FRiF QC_hg38/H9_PRO-seq_1_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 15:35:02) elapsed: 58.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_exons_sort.bed (33698,33699)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.178GB.
PID: 33698; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 33699; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_introns_sort.bed (33705,33706,33707)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.178GB.
PID: 33705; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 33707; Command: bedtools; Return code: 0; Memory used: 0.005GB
PID: 33706; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_coverage.bed (33719)


Command completed. Elapsed time: 0:00:26. Running peak memory: 6.178GB.
PID: 33719; Command: bedtools; Return code: 0; Memory used: 0.013GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_coverage.bed (33747)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.178GB.
PID: 33747; Command: bedtools; Return code: 0; Memory used: 0.055GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/20.754829)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_rpkm.bed (33772,33773,33774)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33772; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 33774; Command: sort; Return code: 0; Memory used: 0.003GB
PID: 33773; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/20.754829)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_rpkm.bed (33776,33777,33778)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.178GB.
PID: 33776; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 33778; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 33777; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed (33781,33782,33783)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33781; Command: join; Return code: 0; Memory used: 0.001GB
PID: 33783; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 33782; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.23 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed --annotate (33789)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.178GB.
PID: 33789; Command: Rscript; Return code: 0; Memory used: 0.317GB

mRNA contamination QC_hg38/H9_PRO-seq_1_mRNA_contamination.pdf mRNA contamination QC_hg38/H9_PRO-seq_1_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/QC_hg38/H9_PRO-seq_1_exon_intron_ratios.bed (33810)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.178GB.
PID: 33810; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 15:36:13) elapsed: 71.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam (33818)


Command completed. Elapsed time: 0:00:10. Running peak memory: 6.178GB.
PID: 33818; Command: samtools; Return code: 0; Memory used: 0.008GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 20754829.0 (33829)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_plus.bam'
Temporary files will be stored in: 'tmp_H9_PRO-seq_1_plus_cuttrace_exvi9dtb'
Processing with 4 cores...
stdin is empty of data
Discarding 115 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270720v1_random', 'chr14_KI270724v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 80 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr9_KI270717v1_random', 'chr9_KI270719v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270438v1', 'chrUn_KI270515v1', 'chrUn_KI270539v1', 'chrUn_KI270587v1', 'chrUn_KI270589v1', 'chrUn_KI270584v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 80 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_exact_body_0-mer.bw'
Merging 80 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:06:18. Running peak memory: 6.178GB.
PID: 33829; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 3.346GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam (35275)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.178GB.
PID: 35275; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 20754829.0 (35283)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/aligned_hg38/H9_PRO-seq_1_minus.bam'
Temporary files will be stored in: 'tmp_H9_PRO-seq_1_minus_cuttrace_j2gcnfml'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
Discarding 109 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr9_KI270717v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_KI270722v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270735v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1']
Keeping 86 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_exact_body_0-mer.bw'
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_1/signal_hg38/H9_PRO-seq_1_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:12. Running peak memory: 6.178GB.
PID: 35283; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.763GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 2:50:51
  • Total elapsed time (all runs): 5:20:58
  • Peak memory (this run): 6.178 GB
  • Pipeline completed time: 2020-06-15 15:50:01