Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_PRO-seq_3 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-34c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/
  • Pipeline started at: (06-15 07:17:16) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_PRO-seq_3
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz

File_mb 2340.86 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz (261654)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 261654; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz (261658)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.0GB.
PID: 261658; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1.fastq (261663)


Command completed. Elapsed time: 0:02:18. Running peak memory: 0.002GB.
PID: 261663; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2.fastq (27124)


Command completed. Elapsed time: 0:02:15. Running peak memory: 0.002GB.
PID: 27124; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 92628962 PEPPRO RES

Fastq_reads 92628962 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz']

FASTQ processing: (06-15 07:23:30) elapsed: 373.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R1_cutadapt.txt (233633)


Command completed. Elapsed time: 0:01:31. Running peak memory: 3.239GB.
PID: 233633; Command: cutadapt; Return code: 0; Memory used: 3.239GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (233962,233963)


Command completed. Elapsed time: 0:01:01. Running peak memory: 3.239GB.
PID: 233962; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 233963; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 27419170 PEPPRO RES

Trim_loss_rate 70.4 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (234067)


Got SIGTERM. Failing gracefully... (06-15 12:57:37) elapsed: 20046.0 TIME
Child process 234067 (fastqc) terminated after 0 sec.
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/recover.lock.fastq__H9_PRO-seq_3_R1_processed.fastq
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/recover.lock.trimmed_fastqc

Pipeline failed at: (06-15 12:57:37) elapsed: 0.0 TIME

Total time: 5:40:22 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_PRO-seq_3 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba27-33c1
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/
  • Pipeline started at: (06-15 12:59:45) elapsed: 35.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_PRO-seq_3
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_DMSO_rep3_PE2.fastq.gz

File_mb 2340.86 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1.fastq
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/H9_PRO-seq_3_R2.fastq.gz']

FASTQ processing: (06-15 12:59:46) elapsed: 0.0 TIME

cutadapt --version Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/lock.fastq__H9_PRO-seq_3_R1_processed.fastq Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R1_cutadapt.txt (374018)


Command completed. Elapsed time: 0:00:53. Running peak memory: 3.233GB.
PID: 374018; Command: cutadapt; Return code: 0; Memory used: 3.233GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (374356,374357)


Command completed. Elapsed time: 0:00:24. Running peak memory: 3.233GB.
PID: 374356; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 374357; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 27419170 PEPPRO RES

Trim_loss_rate 70.4 PEPPRO RES Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/lock.trimmed_fastqc Overwriting target... Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (374400)

Started analysis of H9_PRO-seq_3_R1_processed.fastq
Approx 5% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 10% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 15% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 20% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 25% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 30% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 35% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 40% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 45% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 50% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 55% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 60% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 65% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 70% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 75% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 80% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 85% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 90% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 95% complete for H9_PRO-seq_3_R1_processed.fastq
Analysis complete for H9_PRO-seq_3_R1_processed.fastq
Command completed. Elapsed time: 0:01:00. Running peak memory: 3.233GB.
PID: 374400; Command: fastqc; Return code: 0; Memory used: 0.181GB

FastQC report r1 fastqc/H9_PRO-seq_3_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq (374469)

[INFO] 1862033 duplicated records removed
Command completed. Elapsed time: 0:00:48. Running peak memory: 3.233GB.
PID: 374469; Command: seqkit; Return code: 0; Memory used: 2.006GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq (374528,374529)


Command completed. Elapsed time: 0:00:22. Running peak memory: 3.233GB.
PID: 374528; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 374529; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 34725419.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 18106301.0 PEPPRO RES

Duplicate_reads 1862033.0 PEPPRO RES

Pct_uninformative_adapter_reads 39.0943 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/processed_R1.flag (374598)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.233GB.
PID: 374598; Command: touch; Return code: 0; Memory used: 0.0GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_R2_cutadapt.txt (374600)


Command completed. Elapsed time: 0:00:54. Running peak memory: 3.463GB.
PID: 374600; Command: cutadapt; Return code: 0; Memory used: 3.463GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq (374674,374676)


Command completed. Elapsed time: 0:00:24. Running peak memory: 3.463GB.
PID: 374674; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 374676; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 54838340 PEPPRO RES

Trim_loss_rate 40.8 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (374900)

Started analysis of H9_PRO-seq_3_R1_processed.fastq
Approx 5% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 10% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 15% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 20% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 25% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 30% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 35% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 40% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 45% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 50% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 55% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 60% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 65% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 70% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 75% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 80% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 85% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 90% complete for H9_PRO-seq_3_R1_processed.fastq
Approx 95% complete for H9_PRO-seq_3_R1_processed.fastq
Analysis complete for H9_PRO-seq_3_R1_processed.fastq
Command completed. Elapsed time: 0:01:02. Running peak memory: 3.463GB.
PID: 374900; Command: fastqc; Return code: 0; Memory used: 0.178GB

FastQC report r1 fastqc/H9_PRO-seq_3_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq (374971)

Started analysis of H9_PRO-seq_3_R2_trimmed.fastq
Approx 5% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 10% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 15% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 20% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 25% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 30% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 35% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 40% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 45% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 50% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 55% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 60% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 65% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 70% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 75% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 80% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 85% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 90% complete for H9_PRO-seq_3_R2_trimmed.fastq
Approx 95% complete for H9_PRO-seq_3_R2_trimmed.fastq
Analysis complete for H9_PRO-seq_3_R2_trimmed.fastq
Command completed. Elapsed time: 0:00:57. Running peak memory: 3.463GB.
PID: 374971; Command: fastqc; Return code: 0; Memory used: 0.171GB

FastQC report r2 fastqc/H9_PRO-seq_3_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.histogram

fastq_pair -t 83366065 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq (375045)

Left paired: 28081513       Right paired: 28081513
Left single: 126667     Right single: 1382160
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:02:58. Running peak memory: 6.109GB.
PID: 375045; Command: fastq_pair; Return code: 0; Memory used: 6.109GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_noadap.fastq.paired.fq -o H9_PRO-seq_3 -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt (375234)


Command completed. Elapsed time: 0:00:56. Running peak memory: 6.109GB.
PID: 375234; Command: flash; Return code: 0; Memory used: 0.098GB

Plot adapter insertion distribution (06-15 13:10:57) elapsed: 671.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt -u 8 (375678)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.109GB.
PID: 375678; Command: Rscript; Return code: 0; Memory used: 0.316GB

Adapter insertion distribution cutadapt/H9_PRO-seq_3_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/H9_PRO-seq_3_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 20 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 13:11:02) elapsed: 5.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/cutadapt/H9_PRO-seq_3.hist

Degradation_ratio 0.9769 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq (375707)


Command completed. Elapsed time: 0:00:22. Running peak memory: 6.109GB.
PID: 375707; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/processed_R2.flag (375726)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 375726; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/repaired.flag

fastq_pair -t 83366065 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq (375727)

Left paired: 27272197       Right paired: 27272197
Left single: 146973     Right single: 1431712
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:03:15. Running peak memory: 6.109GB.
PID: 375727; Command: fastq_pair; Return code: 0; Memory used: 5.962GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq (375897)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 375897; Command: mv; Return code: 0; Memory used: 0.002GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq (375898)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 375898; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/repaired.flag (375900)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 375900; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/dups_repaired.flag

fastq_pair -t 83366065 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq (375901)

Left paired: 25551175       Right paired: 25551175
Left single: 94450      Right single: 3152734
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:02:45. Running peak memory: 6.109GB.
PID: 375901; Command: fastq_pair; Return code: 0; Memory used: 5.253GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq (376242)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 376242; Command: mv; Return code: 0; Memory used: 0.002GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq (376244)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 376244; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/dups_repaired.flag (376245)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 376245; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 13:17:26) elapsed: 384.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 13:17:26) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_bt2 (376246)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 376246; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq (376247)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_PRO-seq_3 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 27272197 reads; of these: 27272197 (100.00%) were unpaired; of these: 24569260 (90.09%) aligned 0 times 2702937 (9.91%) aligned exactly 1 time 0 (0.00%) aligned >1 times 9.91% overall alignment rate

Aligned_reads_human_rDNA 5405874.0 PEPPRO RES

Alignment_rate_human_rDNA 9.86 PEPPRO RES

Map to human_rDNA (06-15 13:20:55) elapsed: 208.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_dups_bt2 (377186)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 377186; Command: mkfifo; Return code: 0; Memory used: 0.002GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_dups_R2.fq (377187)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_PRO-seq_3 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/fastq/H9_PRO-seq_3_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 2702937 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 13:24:53) elapsed: 238.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_PRO-seq_3 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/tmpofh5asc7 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam (381212,381213,381214)

2244415 reads skipped
0 reads lost
24569260 reads; of these:
  24569260 (100.00%) were paired; of these:
    9705626 (39.50%) aligned concordantly 0 times
    12263897 (49.92%) aligned concordantly exactly 1 time
    2599737 (10.58%) aligned concordantly >1 times
    ----
    9705626 pairs aligned concordantly 0 times; of these:
      2262313 (23.31%) aligned discordantly 1 time
    ----
    7443313 pairs aligned 0 times concordantly or discordantly; of these:
      14886626 mates make up the pairs; of these:
        5843431 (39.25%) aligned 0 times
        3306807 (22.21%) aligned exactly 1 time
        5736388 (38.53%) aligned >1 times
88.11% overall alignment rate
[bam_sort_core] merging from 14 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:50:45. Running peak memory: 6.109GB.
PID: 381213; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 381212; Command: bowtie2; Return code: 0; Memory used: 3.765GB
PID: 381214; Command: samtools; Return code: 0; Memory used: 0.898GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam (395318)


Command completed. Elapsed time: 0:02:09. Running peak memory: 6.109GB.
PID: 395318; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 43295089 PEPPRO RES

QC_filtered_reads 25127415 PEPPRO RES

Aligned_reads 18167674.5 PEPPRO RES

Alignment_rate 33.13 PEPPRO RES

Total_efficiency 19.61 PEPPRO RES

Read_depth 2.98 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_PRO-seq_3 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/tmpofh5asc7 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp_dups.bam (401719,401724,401725)

23306760 reads; of these:
  23306760 (100.00%) were paired; of these:
    9052177 (38.84%) aligned concordantly 0 times
    11774634 (50.52%) aligned concordantly exactly 1 time
    2479949 (10.64%) aligned concordantly >1 times
    ----
    9052177 pairs aligned concordantly 0 times; of these:
      2177215 (24.05%) aligned discordantly 1 time
    ----
    6874962 pairs aligned 0 times concordantly or discordantly; of these:
      13749924 mates make up the pairs; of these:
        5423690 (39.45%) aligned 0 times
        3177751 (23.11%) aligned exactly 1 time
        5148483 (37.44%) aligned >1 times
88.36% overall alignment rate
[bam_sort_core] merging from 13 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:47:32. Running peak memory: 6.109GB.
PID: 401719; Command: bowtie2; Return code: 0; Memory used: 3.762GB
PID: 401724; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 401725; Command: samtools; Return code: 0; Memory used: 0.921GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam (454442)


Command completed. Elapsed time: 0:01:26. Running peak memory: 6.109GB.
PID: 454442; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 15:20:43) elapsed: 6950.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R2.fq (21123)


Command completed. Elapsed time: 0:00:22. Running peak memory: 6.109GB.
PID: 21123; Command: pigz; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/prealignments/H9_PRO-seq_3_human_rDNA_unmap_R1.fq (28309)


Command completed. Elapsed time: 0:00:24. Running peak memory: 6.109GB.
PID: 28309; Command: pigz; Return code: 0; Memory used: 0.011GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam (30700)


Command completed. Elapsed time: 0:00:40. Running peak memory: 6.109GB.
PID: 30700; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 711009 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam (35171)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.109GB.
PID: 35171; Command: samtools; Return code: 0; Memory used: 0.011GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/chr_sizes.bed (35239,35240,35241,35242)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 35241; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 35239; Command: samtools; Return code: 0; Memory used: 0.009GB
PID: 35242; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 35240; Command: cut; Return code: 0; Memory used: 0.001GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_noMT.bam (35244)


Command completed. Elapsed time: 0:00:39. Running peak memory: 6.109GB.
PID: 35244; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam (35321)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 35321; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam (35322)


Command completed. Elapsed time: 0:00:28. Running peak memory: 6.109GB.
PID: 35322; Command: samtools; Return code: 0; Memory used: 0.012GB

Split BAM file (06-15 15:23:45) elapsed: 182.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam (38421,38436)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:41. Running peak memory: 6.109GB.
PID: 38421; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 38436; Command: samtools; Return code: 0; Memory used: 5.156GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE2.bam (77855,77860)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:17. Running peak memory: 6.109GB.
PID: 77860; Command: samtools; Return code: 0; Memory used: 4.019GB
PID: 77855; Command: samtools; Return code: 0; Memory used: 0.004GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp_dups.bam (79965)


Command completed. Elapsed time: 0:00:39. Running peak memory: 6.109GB.
PID: 79965; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE1.bam (80272,80273)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:42. Running peak memory: 6.109GB.
PID: 80272; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 80273; Command: samtools; Return code: 0; Memory used: 5.033GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE2.bam (118983,118984)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:10. Running peak memory: 6.109GB.
PID: 118983; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 118984; Command: samtools; Return code: 0; Memory used: 4.074GB

Calculate library complexity (06-15 15:35:16) elapsed: 690.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE1.bam (119394)

BAM_INPUT
TOTAL READS     = 19005606
COUNTS_SUM      = 19005606
DISTINCT READS  = 1.58447e+07
DISTINCT COUNTS = 285
MAX COUNT       = 19581
COUNTS OF 1     = 1.42036e+07
OBSERVED COUNTS (19582)
1   14203580
2   1156600
3   254232
4   94789
5   45836
6   26066
7   16009
8   10530
9   7388
10  5314
11  3937
12  3035
13  2237
14  1796
15  1517
16  1252
17  1031
18  892
19  767
20  636
21  535
22  462
23  411
24  386
25  367
26  297
27  272
28  227
29  236
30  215
31  209
32  162
33  160
34  160
35  150
36  126
37  130
38  108
39  116
40  107
41  94
42  95
43  81
44  70
45  69
46  67
47  68
48  59
49  70
50  59
51  60
52  65
53  42
54  43
55  50
56  44
57  45
58  37
59  39
60  31
61  47
62  32
63  28
64  33
65  38
66  28
67  31
68  33
69  29
70  31
71  21
72  20
73  18
74  21
75  24
76  18
77  28
78  20
79  17
80  17
81  14
82  17
83  14
84  13
85  13
86  17
87  11
88  17
89  14
90  8
91  13
92  10
93  15
94  14
95  11
96  5
97  13
98  10
99  10
100 12
101 3
102 14
103 11
104 8
105 15
106 9
107 9
108 9
109 6
110 9
111 5
112 4
113 4
114 6
115 12
116 1
117 7
118 6
119 9
120 4
121 2
122 3
123 4
124 5
125 4
126 3
127 4
128 7
129 7
130 2
131 5
132 3
133 5
134 8
135 3
136 5
137 4
138 7
139 2
140 2
141 3
142 4
143 3
144 6
145 3
146 6
147 2
148 1
149 5
150 2
151 3
152 4
153 5
154 2
155 5
156 3
157 4
158 5
159 2
160 4
161 2
162 1
163 3
164 1
166 3
167 1
168 3
169 3
170 3
172 3
173 6
174 1
175 2
176 2
177 1
178 2
179 1
181 1
183 1
184 3
185 3
186 1
187 1
188 2
189 1
190 1
191 2
193 3
194 1
195 2
196 2
197 3
199 3
200 2
201 2
202 2
203 4
204 1
205 1
207 4
208 1
210 1
211 1
212 1
213 2
214 2
216 1
217 2
223 3
224 1
225 1
226 1
229 2
231 2
233 1
234 1
235 1
238 1
239 1
242 2
246 1
247 1
248 3
250 1
254 1
256 2
259 2
260 1
264 1
271 1
274 1
276 1
284 2
294 1
299 1
304 1
305 1
318 1
334 1
335 1
348 1
351 1
353 1
357 1
366 1
390 2
391 1
393 1
394 1
397 1
422 1
432 1
443 1
450 1
467 1
469 1
500 1
508 1
513 1
516 1
526 1
537 1
543 1
560 1
577 1
582 1
611 1
619 1
653 1
697 1
887 1
939 1
964 1
1000    1
1280    1
1283    1
1718    1
1790    1
1929    1
2740    1
6648    1
7571    1
9539    1
16742   1
19581   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 sample size: 19000000 Command completed. Elapsed time: 0:01:47. Running peak memory: 6.109GB.
PID: 119394; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE1.bam (157921)

BAM_INPUT
TOTAL READS     = 19005606
DISTINCT READS  = 1.58447e+07
DISTINCT COUNTS = 285
MAX COUNT       = 19581
COUNTS OF 1     = 1.42036e+07
MAX TERMS       = 100
OBSERVED COUNTS (19582)
1   14203580
2   1156600
3   254232
4   94789
5   45836
6   26066
7   16009
8   10530
9   7388
10  5314
11  3937
12  3035
13  2237
14  1796
15  1517
16  1252
17  1031
18  892
19  767
20  636
21  535
22  462
23  411
24  386
25  367
26  297
27  272
28  227
29  236
30  215
31  209
32  162
33  160
34  160
35  150
36  126
37  130
38  108
39  116
40  107
41  94
42  95
43  81
44  70
45  69
46  67
47  68
48  59
49  70
50  59
51  60
52  65
53  42
54  43
55  50
56  44
57  45
58  37
59  39
60  31
61  47
62  32
63  28
64  33
65  38
66  28
67  31
68  33
69  29
70  31
71  21
72  20
73  18
74  21
75  24
76  18
77  28
78  20
79  17
80  17
81  14
82  17
83  14
84  13
85  13
86  17
87  11
88  17
89  14
90  8
91  13
92  10
93  15
94  14
95  11
96  5
97  13
98  10
99  10
100 12
101 3
102 14
103 11
104 8
105 15
106 9
107 9
108 9
109 6
110 9
111 5
112 4
113 4
114 6
115 12
116 1
117 7
118 6
119 9
120 4
121 2
122 3
123 4
124 5
125 4
126 3
127 4
128 7
129 7
130 2
131 5
132 3
133 5
134 8
135 3
136 5
137 4
138 7
139 2
140 2
141 3
142 4
143 3
144 6
145 3
146 6
147 2
148 1
149 5
150 2
151 3
152 4
153 5
154 2
155 5
156 3
157 4
158 5
159 2
160 4
161 2
162 1
163 3
164 1
166 3
167 1
168 3
169 3
170 3
172 3
173 6
174 1
175 2
176 2
177 1
178 2
179 1
181 1
183 1
184 3
185 3
186 1
187 1
188 2
189 1
190 1
191 2
193 3
194 1
195 2
196 2
197 3
199 3
200 2
201 2
202 2
203 4
204 1
205 1
207 4
208 1
210 1
211 1
212 1
213 2
214 2
216 1
217 2
223 3
224 1
225 1
226 1
229 2
231 2
233 1
234 1
235 1
238 1
239 1
242 2
246 1
247 1
248 3
250 1
254 1
256 2
259 2
260 1
264 1
271 1
274 1
276 1
284 2
294 1
299 1
304 1
305 1
318 1
334 1
335 1
348 1
351 1
353 1
357 1
366 1
390 2
391 1
393 1
394 1
397 1
422 1
432 1
443 1
450 1
467 1
469 1
500 1
508 1
513 1
516 1
526 1
537 1
543 1
560 1
577 1
582 1
611 1
619 1
653 1
697 1
887 1
939 1
964 1
1000    1
1280    1
1283    1
1718    1
1790    1
1929    1
2740    1
6648    1
7571    1
9539    1
16742   1
19581   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] .................................................................................................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:02:04. Running peak memory: 6.109GB.
PID: 157921; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_counts.txt (191204)


Command completed. Elapsed time: 0:00:32. Running peak memory: 6.109GB.
PID: 191204; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_plot (191240)

Processing H9_PRO-seq_3
INFO: Found real counts for H9_PRO-seq_3 - Total (M): 19.481041 Unique (M): 19.005606

Library complexity plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.109GB.
PID: 191240; Command: Rscript; Return code: 0; Memory used: 0.273GB

Library complexity QC_hg38/H9_PRO-seq_3_preseq_plot.pdf Library complexity QC_hg38/H9_PRO-seq_3_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.8821 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 15:39:44) elapsed: 269.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam (191263)


Command completed. Elapsed time: 0:00:17. Running peak memory: 6.109GB.
PID: 191263; Command: samtools; Return code: 0; Memory used: 0.015GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_bamQC.tsv (191278)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/tmp_H9_PRO-seq_3_PE1_svpmvopz'
Processing with 12 cores...
Discarding 101 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr9_KI270717v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270748v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1']
Keeping 94 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270333v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:22. Running peak memory: 6.109GB.
PID: 191278; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.51GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 9740520.5 PEPPRO RES

PBC2 9740520.5 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_unmap.bam (191640)


Command completed. Elapsed time: 0:00:09. Running peak memory: 6.109GB.
PID: 191640; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_temp.bam

Unmapped_reads 5843431 PEPPRO RES

Split BAM by strand (06-15 15:40:41) elapsed: 57.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam (191711)


Command completed. Elapsed time: 0:01:19. Running peak memory: 6.109GB.
PID: 191711; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam (191798)


Command completed. Elapsed time: 0:01:12. Running peak memory: 6.109GB.
PID: 191798; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 15:43:12) elapsed: 151.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (201242)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 201242; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_plus_TssEnrichment.txt (201333)


Command completed. Elapsed time: 0:00:07. Running peak memory: 6.109GB.
PID: 201333; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.723GB

TSS_coding_score 28.6 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_minus_TssEnrichment.txt (205245)


Command completed. Elapsed time: 0:00:06. Running peak memory: 6.109GB.
PID: 205245; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.763GB

TSS_non-coding_score 10.5 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_minus_TssEnrichment.txt (209694)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:13. Running peak memory: 6.109GB.
PID: 209694; Command: Rscript; Return code: 0; Memory used: 0.123GB

TSS enrichment QC_hg38/H9_PRO-seq_3_TSSenrichment.pdf TSS enrichment QC_hg38/H9_PRO-seq_3_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt (220364,220380,220403,220416)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 220364; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 220403; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 220380; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 220416; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt (220478)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 220478; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-15 15:43:39) elapsed: 27.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_tss.bed (220576,220582)


Command completed. Elapsed time: 0:00:02. Running peak memory: 6.109GB.
PID: 220576; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 220582; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_gene_body.bed (221454,221455)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 221454; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 221455; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_TSS_density.bed (221577,221587,221590,221596)


Command completed. Elapsed time: 0:00:31. Running peak memory: 6.109GB.
PID: 221587; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 221596; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 221577; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 221590; Command: sort; Return code: 0; Memory used: 0.004GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_gene_body_density.bed (228579,228581,228582)


Command completed. Elapsed time: 0:01:10. Running peak memory: 6.109GB.
PID: 228581; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 228579; Command: bedtools; Return code: 0; Memory used: 0.071GB
PID: 228582; Command: sort; Return code: 0; Memory used: 0.003GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/tmpg2fp3lds (230727,230728,230729)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 230727; Command: join; Return code: 0; Memory used: 0.001GB
PID: 230729; Command: env; Return code: 0; Memory used: 0.004GB
PID: 230728; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/tmpg2fp3lds | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0188796) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/tmpg2fp3lds > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed (230735)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 230735; Command: awk; Return code: 0; Memory used: 0.004GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 27.32 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed (230740)

Pause index plot completed!

Command completed. Elapsed time: 0:00:08. Running peak memory: 6.109GB.
PID: 230740; Command: Rscript; Return code: 0; Memory used: 0.201GB

Pause index QC_hg38/H9_PRO-seq_3_pause_index.pdf Pause index QC_hg38/H9_PRO-seq_3_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_pause_index.bed (230781)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 230781; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 15:45:31) elapsed: 112.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam 18167674.5 7066591

Plus_FRiP 0.39 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam 18167674.5 6601482

Minus_FRiP 0.36 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_gene_sort.bed (230862,230863)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 230862; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 230863; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_gene_coverage.bed (230866)


Command completed. Elapsed time: 0:00:38. Running peak memory: 6.109GB.
PID: 230866; Command: bedtools; Return code: 0; Memory used: 0.063GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed.gz (230902)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 230902; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed (230903)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 230903; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 15:46:47) elapsed: 76.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/raw/hg38_annotations.bed (230911)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 230911; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer_sort.bed (230913,230914,230915,230916)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 230913; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 230914; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 230916; Command: bedtools; Return code: 0; Memory used: 0.044GB
PID: 230915; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_plus_coverage.bed (230919)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.109GB.
PID: 230919; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_minus_coverage.bed (230932)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.109GB.
PID: 230932; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_sort.bed (230944,230945,230946,230947)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 230944; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 230945; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 230947; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 230946; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_plus_coverage.bed (230950)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 230950; Command: bedtools; Return code: 0; Memory used: 0.021GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_minus_coverage.bed (245408)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 245408; Command: bedtools; Return code: 0; Memory used: 0.038GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region" (264353)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 264353; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region_sort.bed (264409,264414,264421,264426)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 264409; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 264421; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 264414; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 264426; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_plus_coverage.bed (265975)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.109GB.
PID: 265975; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_minus_coverage.bed (269452)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 269452; Command: bedtools; Return code: 0; Memory used: 0.021GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR" (269467)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 269467; Command: mv; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR_sort.bed (269468,269470,269471,269472)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 269468; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 269470; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 269472; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 269471; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_plus_coverage.bed (269474)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 269474; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_minus_coverage.bed (269488)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 269488; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR" (269516)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 269516; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR_sort.bed (269517,269518,269519,269520)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 269517; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 269518; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 269520; Command: bedtools; Return code: 0; Memory used: 0.034GB
PID: 269519; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_plus_coverage.bed (269523)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.109GB.
PID: 269523; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_minus_coverage.bed (269537)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.109GB.
PID: 269537; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon_sort.bed (269562,269563,269564,269565)


Command completed. Elapsed time: 0:00:03. Running peak memory: 6.109GB.
PID: 269562; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 269563; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 269565; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 269564; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_plus_coverage.bed (269570)


Command completed. Elapsed time: 0:00:18. Running peak memory: 6.109GB.
PID: 269570; Command: bedtools; Return code: 0; Memory used: 0.023GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_minus_coverage.bed (269751)


Command completed. Elapsed time: 0:00:16. Running peak memory: 6.109GB.
PID: 269751; Command: bedtools; Return code: 0; Memory used: 0.018GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron_sort.bed (282124,282249,282254,282255)


Command completed. Elapsed time: 0:00:02. Running peak memory: 6.109GB.
PID: 282124; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 282254; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 282249; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 282255; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_plus_coverage.bed (283800)


Command completed. Elapsed time: 0:00:24. Running peak memory: 6.109GB.
PID: 283800; Command: bedtools; Return code: 0; Memory used: 0.058GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_minus_coverage.bed (299691)


Command completed. Elapsed time: 0:00:23. Running peak memory: 6.109GB.
PID: 299691; Command: bedtools; Return code: 0; Memory used: 0.037GB

Plot cFRiF/FRiF (06-15 15:50:43) elapsed: 236.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_PRO-seq_3 -z 3099922541 -n 9939223 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_plus_coverage.bed (308434)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:01:01. Running peak memory: 6.109GB.
PID: 308434; Command: Rscript; Return code: 0; Memory used: 0.557GB

cFRiF QC_hg38/H9_PRO-seq_3_cFRiF.pdf cFRiF QC_hg38/H9_PRO-seq_3_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_PRO-seq_3 -z 3099922541 -n 9939223 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_Intron_plus_coverage.bed (308508)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:41. Running peak memory: 6.109GB.
PID: 308508; Command: Rscript; Return code: 0; Memory used: 0.442GB

FRiF QC_hg38/H9_PRO-seq_3_FRiF.pdf FRiF QC_hg38/H9_PRO-seq_3_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 15:52:27) elapsed: 104.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_exons_sort.bed (308606,308607)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.109GB.
PID: 308607; Command: bedtools; Return code: 0; Memory used: 0.087GB
PID: 308606; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_introns_sort.bed (308613,308614,308615)


Command completed. Elapsed time: 0:00:06. Running peak memory: 6.109GB.
PID: 308613; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 308615; Command: bedtools; Return code: 0; Memory used: 0.003GB
PID: 308614; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_coverage.bed (308622)


Command completed. Elapsed time: 0:00:26. Running peak memory: 6.109GB.
PID: 308622; Command: bedtools; Return code: 0; Memory used: 0.012GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_coverage.bed (308647)


Command completed. Elapsed time: 0:00:44. Running peak memory: 6.109GB.
PID: 308647; Command: bedtools; Return code: 0; Memory used: 0.031GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.1676745)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_rpkm.bed (316390,316391,316392)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 316390; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 316392; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 316391; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.1676745)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_rpkm.bed (316783,316796,316797)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.109GB.
PID: 316783; Command: awk; Return code: 0; Memory used: 0.009GB
PID: 316797; Command: sort; Return code: 0; Memory used: 0.003GB
PID: 316796; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed (317244,317260,317268)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 317244; Command: join; Return code: 0; Memory used: 0.001GB
PID: 317268; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 317260; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.28 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed --annotate (317508)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:11. Running peak memory: 6.109GB.
PID: 317508; Command: Rscript; Return code: 0; Memory used: 0.11GB

mRNA contamination QC_hg38/H9_PRO-seq_3_mRNA_contamination.pdf mRNA contamination QC_hg38/H9_PRO-seq_3_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/QC_hg38/H9_PRO-seq_3_exon_intron_ratios.bed (322436)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.109GB.
PID: 322436; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 15:54:00) elapsed: 93.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam (322534)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.109GB.
PID: 322534; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18167674.5 (327192)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_plus.bam'
Temporary files will be stored in: 'tmp_H9_PRO-seq_3_plus_cuttrace_wm7hae5s'
Processing with 4 cores...
Discarding 112 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1']
Keeping 83 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 83 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_exact_body_0-mer.bw'
Merging 83 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:08:15. Running peak memory: 6.109GB.
PID: 327192; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.595GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam (415919)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.109GB.
PID: 415919; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18167674.5 (415926)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/aligned_hg38/H9_PRO-seq_3_minus.bam'
Temporary files will be stored in: 'tmp_H9_PRO-seq_3_minus_cuttrace_bf2ykl7_'
Processing with 4 cores...
stdin is empty of data
Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr9_KI270717v1_random', 'chr14_KI270723v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270737v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1']
Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270333v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_exact_body_0-mer.bw'
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_PRO-seq_3/signal_hg38/H9_PRO-seq_3_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:48. Running peak memory: 6.109GB.
PID: 415926; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.752GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 3:11:09
  • Total elapsed time (all runs): 5:59:47
  • Peak memory (this run): 6.1094 GB
  • Pipeline completed time: 2020-06-15 16:10:19