Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_treated_PRO-seq_1 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba27-28c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/
  • Pipeline started at: (06-15 07:17:18) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_treated_PRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE2.fastq.gz

File_mb 2710.39 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R1.fastq.gz (138708)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 138708; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep1_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R2.fastq.gz (138711)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 138711; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1.fastq (138714)


Command completed. Elapsed time: 0:02:34. Running peak memory: 0.002GB.
PID: 138714; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2.fastq (31182)


Command completed. Elapsed time: 0:01:45. Running peak memory: 0.002GB.
PID: 31182; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 111300168 PEPPRO RES

Fastq_reads 111300168 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/H9_treated_PRO-seq_1_R2.fastq.gz']

FASTQ processing: (06-15 07:24:45) elapsed: 446.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_R1_cutadapt.txt (3305)


Command completed. Elapsed time: 0:01:45. Running peak memory: 3.069GB.
PID: 3305; Command: cutadapt; Return code: 0; Memory used: 3.069GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq (3668,3669)


Command completed. Elapsed time: 0:01:16. Running peak memory: 3.069GB.
PID: 3669; Command: seqtk; Return code: 0; Memory used: 0.002GB
PID: 3668; Command: seqtk; Return code: 0; Memory used: 0.001GB

Evaluating read trimming

Trimmed_reads 29119715 PEPPRO RES

Trim_loss_rate 73.84 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq (3741)

Started analysis of H9_treated_PRO-seq_1_R1_processed.fastq
Approx 5% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 10% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 15% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 20% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 25% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 30% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 35% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 40% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 45% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 50% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 55% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 60% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 65% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 70% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 75% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 80% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 85% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 90% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 95% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Analysis complete for H9_treated_PRO-seq_1_R1_processed.fastq
Command completed. Elapsed time: 0:01:02. Running peak memory: 3.069GB.
PID: 3741; Command: fastqc; Return code: 0; Memory used: 0.179GB

FastQC report r1 fastqc/H9_treated_PRO-seq_1_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq (3820)

[INFO] 2891628 duplicated records removed
Command completed. Elapsed time: 0:01:12. Running peak memory: 3.069GB.
PID: 3820; Command: seqkit; Return code: 0; Memory used: 1.444GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq (4205,4206)


Command completed. Elapsed time: 0:00:35. Running peak memory: 3.069GB.
PID: 4205; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 4206; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 43631018.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 25201427.0 PEPPRO RES

Duplicate_reads 2891628.0 PEPPRO RES

Pct_uninformative_adapter_reads 45.2855 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/processed_R1.flag (4363)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.069GB.
PID: 4363; Command: touch; Return code: 0; Memory used: 0.0GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_R2_cutadapt.txt (4366)


Command completed. Elapsed time: 0:01:41. Running peak memory: 3.14GB.
PID: 4366; Command: cutadapt; Return code: 0; Memory used: 3.14GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq (4511,4512)


Command completed. Elapsed time: 0:01:04. Running peak memory: 3.14GB.
PID: 4512; Command: seqtk; Return code: 0; Memory used: 0.002GB
PID: 4511; Command: seqtk; Return code: 0; Memory used: 0.001GB

Evaluating read trimming

Trimmed_reads 58239430 PEPPRO RES

Trim_loss_rate 47.67 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq (4880)

Started analysis of H9_treated_PRO-seq_1_R1_processed.fastq
Approx 5% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 10% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 15% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 20% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 25% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 30% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 35% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 40% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 45% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 50% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 55% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 60% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 65% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 70% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 75% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 80% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 85% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 90% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Approx 95% complete for H9_treated_PRO-seq_1_R1_processed.fastq
Analysis complete for H9_treated_PRO-seq_1_R1_processed.fastq
Command completed. Elapsed time: 0:01:04. Running peak memory: 3.14GB.
PID: 4880; Command: fastqc; Return code: 0; Memory used: 0.176GB

FastQC report r1 fastqc/H9_treated_PRO-seq_1_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq (4962)

Started analysis of H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 5% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 10% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 15% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 20% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 25% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 30% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 35% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 40% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 45% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 50% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 55% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 60% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 65% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 70% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 75% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 80% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 85% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 90% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Approx 95% complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Analysis complete for H9_treated_PRO-seq_1_R2_trimmed.fastq
Command completed. Elapsed time: 0:01:22. Running peak memory: 3.14GB.
PID: 4962; Command: fastqc; Return code: 0; Memory used: 0.162GB

FastQC report r2 fastqc/H9_treated_PRO-seq_1_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.histogram

fastq_pair -t 100170151 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq (5090)

Left paired: 30307647       Right paired: 30307647
Left single: 141010     Right single: 2158148
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:03:15. Running peak memory: 6.727GB.
PID: 5090; Command: fastq_pair; Return code: 0; Memory used: 6.727GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_noadap.fastq.paired.fq -o H9_treated_PRO-seq_1 -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt (5534)


Command completed. Elapsed time: 0:01:26. Running peak memory: 6.727GB.
PID: 5534; Command: flash; Return code: 0; Memory used: 0.115GB

Plot adapter insertion distribution (06-15 07:42:16) elapsed: 1051.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt -u 8 (5753)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:08. Running peak memory: 6.727GB.
PID: 5753; Command: Rscript; Return code: 0; Memory used: 0.112GB

Adapter insertion distribution cutadapt/H9_treated_PRO-seq_1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/H9_treated_PRO-seq_1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 20 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:42:24) elapsed: 8.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/cutadapt/H9_treated_PRO-seq_1.hist

Degradation_ratio 1.158 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq (5784)


Command completed. Elapsed time: 0:00:23. Running peak memory: 6.727GB.
PID: 5784; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/processed_R2.flag (5807)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 5807; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/repaired.flag

fastq_pair -t 100170151 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq (5809)

Left paired: 28948010       Right paired: 28948010
Left single: 171705     Right single: 2245320
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:03:04. Running peak memory: 6.727GB.
PID: 5809; Command: fastq_pair; Return code: 0; Memory used: 6.48GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq (6506)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 6506; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq (6508)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 6508; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/repaired.flag (6509)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 6509; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/dups_repaired.flag

fastq_pair -t 100170151 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq (6511)

Left paired: 26293117       Right paired: 26293117
Left single: 111289     Right single: 4900213
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:02:27. Running peak memory: 6.727GB.
PID: 6511; Command: fastq_pair; Return code: 0; Memory used: 5.33GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq (6640)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 6640; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq (6642)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 6642; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/dups_repaired.flag (6643)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 6643; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 07:48:21) elapsed: 357.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:48:21) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_bt2 (6644)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 6644; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq (6645)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_treated_PRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 28948010 reads; of these: 28948010 (100.00%) were unpaired; of these: 25898407 (89.47%) aligned 0 times 3049603 (10.53%) aligned exactly 1 time 0 (0.00%) aligned >1 times 10.53% overall alignment rate

Aligned_reads_human_rDNA 6099206.0 PEPPRO RES

Alignment_rate_human_rDNA 10.47 PEPPRO RES

Map to human_rDNA (06-15 07:51:54) elapsed: 213.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_dups_bt2 (7114)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 7114; Command: mkfifo; Return code: 0; Memory used: 0.002GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_dups_R2.fq (7115)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_treated_PRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/fastq/H9_treated_PRO-seq_1_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 3049603 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 07:55:12) elapsed: 198.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_treated_PRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/tmpc6_9h7v5 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam (7546,7547,7548)

2503948 reads skipped
0 reads lost
25898407 reads; of these:
  25898407 (100.00%) were paired; of these:
    12391166 (47.85%) aligned concordantly 0 times
    11262767 (43.49%) aligned concordantly exactly 1 time
    2244474 (8.67%) aligned concordantly >1 times
    ----
    12391166 pairs aligned concordantly 0 times; of these:
      2903829 (23.43%) aligned discordantly 1 time
    ----
    9487337 pairs aligned 0 times concordantly or discordantly; of these:
      18974674 mates make up the pairs; of these:
        7715519 (40.66%) aligned 0 times
        3997151 (21.07%) aligned exactly 1 time
        7262004 (38.27%) aligned >1 times
85.10% overall alignment rate
[bam_sort_core] merging from 15 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:49:39. Running peak memory: 6.727GB.
PID: 7547; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 7546; Command: bowtie2; Return code: 0; Memory used: 3.798GB
PID: 7548; Command: samtools; Return code: 0; Memory used: 0.897GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam (12725)


Command completed. Elapsed time: 0:01:39. Running peak memory: 6.727GB.
PID: 12725; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 44081295 PEPPRO RES

QC_filtered_reads 26072183 PEPPRO RES

Aligned_reads 18009111.5 PEPPRO RES

Alignment_rate 30.92 PEPPRO RES

Total_efficiency 16.18 PEPPRO RES

Read_depth 3.41 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_treated_PRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/tmpc6_9h7v5 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp_dups.bam (14144,14149,14150)

23789169 reads; of these:
  23789169 (100.00%) were paired; of these:
    11229616 (47.20%) aligned concordantly 0 times
    10491312 (44.10%) aligned concordantly exactly 1 time
    2068241 (8.69%) aligned concordantly >1 times
    ----
    11229616 pairs aligned concordantly 0 times; of these:
      2715002 (24.18%) aligned discordantly 1 time
    ----
    8514614 pairs aligned 0 times concordantly or discordantly; of these:
      17029228 mates make up the pairs; of these:
        7039185 (41.34%) aligned 0 times
        3733545 (21.92%) aligned exactly 1 time
        6256498 (36.74%) aligned >1 times
85.21% overall alignment rate
[bam_sort_core] merging from 13 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:44:25. Running peak memory: 6.727GB.
PID: 14144; Command: bowtie2; Return code: 0; Memory used: 3.764GB
PID: 14149; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 14150; Command: samtools; Return code: 0; Memory used: 0.895GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam (18832)


Command completed. Elapsed time: 0:01:29. Running peak memory: 6.727GB.
PID: 18832; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 09:44:09) elapsed: 6537.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R2.fq (18927)


Command completed. Elapsed time: 0:00:22. Running peak memory: 6.727GB.
PID: 18927; Command: pigz; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/prealignments/H9_treated_PRO-seq_1_human_rDNA_unmap_R1.fq (18962)


Command completed. Elapsed time: 0:00:25. Running peak memory: 6.727GB.
PID: 18962; Command: pigz; Return code: 0; Memory used: 0.011GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam (19015)


Command completed. Elapsed time: 0:00:37. Running peak memory: 6.727GB.
PID: 19015; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 655778 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam (19245)


Command completed. Elapsed time: 0:00:27. Running peak memory: 6.727GB.
PID: 19245; Command: samtools; Return code: 0; Memory used: 0.012GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/chr_sizes.bed (19284,19285,19286,19287)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 19285; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 19287; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 19284; Command: samtools; Return code: 0; Memory used: 0.01GB
PID: 19286; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_noMT.bam (19289)


Command completed. Elapsed time: 0:00:33. Running peak memory: 6.727GB.
PID: 19289; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam (19347)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 19347; Command: mv; Return code: 0; Memory used: 0.001GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam (19348)


Command completed. Elapsed time: 0:00:31. Running peak memory: 6.727GB.
PID: 19348; Command: samtools; Return code: 0; Memory used: 0.011GB

Split BAM file (06-15 09:47:05) elapsed: 176.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam (19391,19392)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:35. Running peak memory: 6.727GB.
PID: 19391; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 19392; Command: samtools; Return code: 0; Memory used: 5.36GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE2.bam (19658,19659)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:02. Running peak memory: 6.727GB.
PID: 19658; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 19659; Command: samtools; Return code: 0; Memory used: 4.161GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp_dups.bam (20174)


Command completed. Elapsed time: 0:00:35. Running peak memory: 6.727GB.
PID: 20174; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE1.bam (20231,20232)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:29. Running peak memory: 6.727GB.
PID: 20231; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 20232; Command: samtools; Return code: 0; Memory used: 5.071GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE2.bam (20669,20670)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:55. Running peak memory: 6.727GB.
PID: 20669; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 20670; Command: samtools; Return code: 0; Memory used: 3.933GB

Calculate library complexity (06-15 09:57:38) elapsed: 633.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE1.bam (20851)

BAM_INPUT
TOTAL READS     = 18664481
COUNTS_SUM      = 18664481
DISTINCT READS  = 1.40562e+07
DISTINCT COUNTS = 291
MAX COUNT       = 20745
COUNTS OF 1     = 1.22495e+07
OBSERVED COUNTS (20746)
1   12249493
2   1104689
3   295074
4   133371
5   74603
6   47569
7   32572
8   23059
9   16807
10  12896
11  10229
12  7936
13  6444
14  5351
15  4479
16  3679
17  3062
18  2646
19  2181
20  1837
21  1659
22  1506
23  1264
24  1153
25  1027
26  944
27  768
28  727
29  604
30  557
31  516
32  468
33  453
34  389
35  387
36  322
37  310
38  267
39  272
40  254
41  240
42  242
43  218
44  185
45  176
46  145
47  151
48  133
49  124
50  125
51  122
52  98
53  98
54  88
55  88
56  88
57  77
58  88
59  74
60  79
61  68
62  66
63  49
64  54
65  57
66  40
67  48
68  34
69  48
70  43
71  38
72  35
73  27
74  25
75  38
76  35
77  24
78  32
79  30
80  36
81  24
82  22
83  31
84  16
85  32
86  20
87  14
88  13
89  12
90  8
91  15
92  6
93  13
94  17
95  19
96  15
97  10
98  9
99  14
100 17
101 13
102 8
103 7
104 14
105 9
106 8
107 7
108 11
109 12
110 7
111 10
112 12
113 5
114 12
115 7
116 11
117 4
118 7
119 8
120 3
121 10
122 11
123 8
124 3
125 8
126 6
127 6
128 2
129 6
130 3
131 3
132 5
133 10
134 2
135 4
136 5
137 4
138 2
139 2
140 2
141 3
142 8
143 3
144 2
145 3
146 4
147 5
148 3
149 3
150 5
152 1
154 2
155 2
156 3
157 4
158 2
159 5
160 3
161 2
162 3
163 5
164 5
166 3
167 6
168 4
169 3
170 1
171 3
172 7
173 2
174 1
175 3
176 1
177 3
178 2
179 1
180 1
181 1
182 2
183 1
184 2
185 3
186 1
187 1
188 1
189 2
190 2
191 2
192 2
194 1
195 1
196 1
197 1
198 2
199 1
200 2
201 2
203 1
204 1
205 1
206 1
208 3
210 1
212 1
213 1
214 1
215 6
217 1
219 1
220 1
221 2
222 2
226 3
229 1
232 3
235 1
238 1
239 1
240 2
241 2
248 2
249 1
254 2
256 1
259 1
261 1
262 1
264 1
265 1
268 2
271 1
272 1
273 1
275 1
285 1
286 1
295 1
296 2
299 1
300 1
301 1
303 1
308 1
313 2
314 1
317 1
334 1
339 1
347 1
348 1
350 1
354 1
361 1
376 1
382 1
391 1
402 1
408 1
411 1
426 1
445 1
451 1
474 1
502 1
506 1
513 1
598 1
614 1
644 1
653 1
710 1
763 1
766 1
796 1
1031    1
1161    1
1187    1
1340    1
1349    1
1417    1
1428    1
1705    1
1759    1
1901    1
2597    1
3806    1
7544    1
7762    1
9871    1
20534   1
20745   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 Command completed. Elapsed time: 0:01:41. Running peak memory: 6.727GB.
PID: 20851; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE1.bam (20976)

BAM_INPUT
TOTAL READS     = 18664481
DISTINCT READS  = 1.40562e+07
DISTINCT COUNTS = 291
MAX COUNT       = 20745
COUNTS OF 1     = 1.22495e+07
MAX TERMS       = 100
OBSERVED COUNTS (20746)
1   12249493
2   1104689
3   295074
4   133371
5   74603
6   47569
7   32572
8   23059
9   16807
10  12896
11  10229
12  7936
13  6444
14  5351
15  4479
16  3679
17  3062
18  2646
19  2181
20  1837
21  1659
22  1506
23  1264
24  1153
25  1027
26  944
27  768
28  727
29  604
30  557
31  516
32  468
33  453
34  389
35  387
36  322
37  310
38  267
39  272
40  254
41  240
42  242
43  218
44  185
45  176
46  145
47  151
48  133
49  124
50  125
51  122
52  98
53  98
54  88
55  88
56  88
57  77
58  88
59  74
60  79
61  68
62  66
63  49
64  54
65  57
66  40
67  48
68  34
69  48
70  43
71  38
72  35
73  27
74  25
75  38
76  35
77  24
78  32
79  30
80  36
81  24
82  22
83  31
84  16
85  32
86  20
87  14
88  13
89  12
90  8
91  15
92  6
93  13
94  17
95  19
96  15
97  10
98  9
99  14
100 17
101 13
102 8
103 7
104 14
105 9
106 8
107 7
108 11
109 12
110 7
111 10
112 12
113 5
114 12
115 7
116 11
117 4
118 7
119 8
120 3
121 10
122 11
123 8
124 3
125 8
126 6
127 6
128 2
129 6
130 3
131 3
132 5
133 10
134 2
135 4
136 5
137 4
138 2
139 2
140 2
141 3
142 8
143 3
144 2
145 3
146 4
147 5
148 3
149 3
150 5
152 1
154 2
155 2
156 3
157 4
158 2
159 5
160 3
161 2
162 3
163 5
164 5
166 3
167 6
168 4
169 3
170 1
171 3
172 7
173 2
174 1
175 3
176 1
177 3
178 2
179 1
180 1
181 1
182 2
183 1
184 2
185 3
186 1
187 1
188 1
189 2
190 2
191 2
192 2
194 1
195 1
196 1
197 1
198 2
199 1
200 2
201 2
203 1
204 1
205 1
206 1
208 3
210 1
212 1
213 1
214 1
215 6
217 1
219 1
220 1
221 2
222 2
226 3
229 1
232 3
235 1
238 1
239 1
240 2
241 2
248 2
249 1
254 2
256 1
259 1
261 1
262 1
264 1
265 1
268 2
271 1
272 1
273 1
275 1
285 1
286 1
295 1
296 2
299 1
300 1
301 1
303 1
308 1
313 2
314 1
317 1
334 1
339 1
347 1
348 1
350 1
354 1
361 1
376 1
382 1
391 1
402 1
408 1
411 1
426 1
445 1
451 1
474 1
502 1
506 1
513 1
598 1
614 1
644 1
653 1
710 1
763 1
766 1
796 1
1031    1
1161    1
1187    1
1340    1
1349    1
1417    1
1428    1
1705    1
1759    1
1901    1
2597    1
3806    1
7544    1
7762    1
9871    1
20534   1
20745   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] ............................................................................._....................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:53. Running peak memory: 6.727GB.
PID: 20976; Command: preseq; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_counts.txt (21425)

psutil.NoSuchProcess process no longer exists (pid=21427)
Warning: couldn't add memory use for process: 21425
Command completed. Elapsed time: 0:00:28. Running peak memory: 6.727GB.
PID: 21425; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_plot (21453)

Processing H9_treated_PRO-seq_1
INFO: Found real counts for H9_treated_PRO-seq_1 - Total (M): 19.73867 Unique (M): 18.664481

Library complexity plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.727GB.
PID: 21453; Command: Rscript; Return code: 0; Memory used: 0.285GB

Library complexity QC_hg38/H9_treated_PRO-seq_1_preseq_plot.pdf Library complexity QC_hg38/H9_treated_PRO-seq_1_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.8094 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 10:01:45) elapsed: 247.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam (21473)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.727GB.
PID: 21473; Command: samtools; Return code: 0; Memory used: 0.016GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_bamQC.tsv (21511)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/tmp_H9_treated_PRO-seq_1_PE1_bybpenda'
Processing with 12 cores...
Discarding 94 chunk(s) of reads: ['chrM', 'chr2_KI270715v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000214v1']
Keeping 101 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:22. Running peak memory: 6.727GB.
PID: 21511; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.306GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 9869335.0 PEPPRO RES

PBC2 9869335.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_unmap.bam (21562)


Command completed. Elapsed time: 0:00:09. Running peak memory: 6.727GB.
PID: 21562; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_temp.bam

Unmapped_reads 7715519 PEPPRO RES

Split BAM by strand (06-15 10:02:39) elapsed: 54.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam (21605)


Command completed. Elapsed time: 0:01:05. Running peak memory: 6.727GB.
PID: 21605; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam (21664)


Command completed. Elapsed time: 0:01:04. Running peak memory: 6.727GB.
PID: 21664; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 10:04:49) elapsed: 130.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (21719)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 21719; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_plus_TssEnrichment.txt (21721)


Command completed. Elapsed time: 0:00:07. Running peak memory: 6.727GB.
PID: 21721; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.981GB

TSS_coding_score 53.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_minus_TssEnrichment.txt (21753)


Command completed. Elapsed time: 0:00:06. Running peak memory: 6.727GB.
PID: 21753; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.978GB

TSS_non-coding_score 17.1 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_minus_TssEnrichment.txt (21880)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.727GB.
PID: 21880; Command: Rscript; Return code: 0; Memory used: 0.316GB

TSS enrichment QC_hg38/H9_treated_PRO-seq_1_TSSenrichment.pdf TSS enrichment QC_hg38/H9_treated_PRO-seq_1_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt (22033,22034,22035,22036)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22033; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 22035; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 22034; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 22036; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt (22038)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22038; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 10:05:08) elapsed: 19.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed (22040,22041)


Command completed. Elapsed time: 0:00:02. Running peak memory: 6.727GB.
PID: 22040; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 22041; Command: bedtools; Return code: 0; Memory used: 0.095GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed (22045,22046)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22045; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 22046; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_TSS_density.bed (22048,22049,22050,22051)


Command completed. Elapsed time: 0:00:26. Running peak memory: 6.727GB.
PID: 22049; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 22051; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 22048; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 22050; Command: sort; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_gene_body_density.bed (22096,22097,22098)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.727GB.
PID: 22097; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 22096; Command: bedtools; Return code: 0; Memory used: 0.057GB
PID: 22098; Command: sort; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/tmpunwmqyci (22154,22155,22156)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22154; Command: join; Return code: 0; Memory used: 0.001GB
PID: 22156; Command: env; Return code: 0; Memory used: 0.006GB
PID: 22155; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/tmpunwmqyci | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0193886) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/tmpunwmqyci > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed (22162)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22162; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 62.8 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed (22167)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.727GB.
PID: 22167; Command: Rscript; Return code: 0; Memory used: 0.316GB

Pause index QC_hg38/H9_treated_PRO-seq_1_pause_index.pdf Pause index QC_hg38/H9_treated_PRO-seq_1_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_pause_index.bed (22190)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22190; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 10:06:11) elapsed: 62.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam 18009111.5 7282779

Plus_FRiP 0.4 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam 18009111.5 6888359

Minus_FRiP 0.38 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_gene_sort.bed (22316,22317)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22316; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 22317; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_gene_coverage.bed (22320)


Command completed. Elapsed time: 0:00:32. Running peak memory: 6.727GB.
PID: 22320; Command: bedtools; Return code: 0; Memory used: 0.06GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed.gz (22382)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22382; Command: ln; Return code: 0; Memory used: 0.0GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed (22383)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22383; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 10:07:19) elapsed: 68.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/raw/hg38_annotations.bed (22392)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22392; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer_sort.bed (22394,22395,22396,22397)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22394; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22395; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 22397; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 22396; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_plus_coverage.bed (22400)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22400; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_minus_coverage.bed (22413)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22413; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_sort.bed (22425,22426,22427,22428)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22425; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22426; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 22428; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 22427; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_plus_coverage.bed (22430)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.727GB.
PID: 22430; Command: bedtools; Return code: 0; Memory used: 0.014GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_minus_coverage.bed (22445)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.727GB.
PID: 22445; Command: bedtools; Return code: 0; Memory used: 0.015GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region" (22457)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22457; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed (22458,22459,22460,22461)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22458; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22460; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 22459; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 22461; Command: bedtools; Return code: 0; Memory used: 0.051GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed (22464)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.727GB.
PID: 22464; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed (22477)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22477; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR" (22491)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22491; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR_sort.bed (22492,22493,22494,22495)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22492; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22493; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 22495; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 22494; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_plus_coverage.bed (22497)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.727GB.
PID: 22497; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_minus_coverage.bed (22510)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22510; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR" (22522)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 22522; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR_sort.bed (22523,22524,22525,22526)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22523; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22524; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 22526; Command: bedtools; Return code: 0; Memory used: 0.034GB
PID: 22525; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_plus_coverage.bed (22528)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22528; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_minus_coverage.bed (22595)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.727GB.
PID: 22595; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon_sort.bed (22642,22643,22644,22645)


Command completed. Elapsed time: 0:00:03. Running peak memory: 6.727GB.
PID: 22642; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22643; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 22645; Command: bedtools; Return code: 0; Memory used: 0.172GB
PID: 22644; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_plus_coverage.bed (22649)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.727GB.
PID: 22649; Command: bedtools; Return code: 0; Memory used: 0.027GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_minus_coverage.bed (22718)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.727GB.
PID: 22718; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron_sort.bed (22770,22771,22772,22773)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 22770; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22772; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 22771; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 22773; Command: bedtools; Return code: 0; Memory used: 0.082GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_plus_coverage.bed (22776)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.727GB.
PID: 22776; Command: bedtools; Return code: 0; Memory used: 0.076GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_minus_coverage.bed (23057)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.727GB.
PID: 23057; Command: bedtools; Return code: 0; Memory used: 0.038GB

Plot cFRiF/FRiF (06-15 10:10:30) elapsed: 191.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_treated_PRO-seq_1 -z 3099922541 -n 10005525 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_plus_coverage.bed (23090)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:35. Running peak memory: 6.727GB.
PID: 23090; Command: Rscript; Return code: 0; Memory used: 0.456GB

cFRiF QC_hg38/H9_treated_PRO-seq_1_cFRiF.pdf cFRiF QC_hg38/H9_treated_PRO-seq_1_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_treated_PRO-seq_1 -z 3099922541 -n 10005525 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_Intron_plus_coverage.bed (23220)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:24. Running peak memory: 6.727GB.
PID: 23220; Command: Rscript; Return code: 0; Memory used: 0.497GB

FRiF QC_hg38/H9_treated_PRO-seq_1_FRiF.pdf FRiF QC_hg38/H9_treated_PRO-seq_1_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 10:11:31) elapsed: 61.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_exons_sort.bed (23262,23263)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.727GB.
PID: 23263; Command: bedtools; Return code: 0; Memory used: 0.096GB
PID: 23262; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_introns_sort.bed (23269,23270,23271)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.727GB.
PID: 23269; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 23271; Command: bedtools; Return code: 0; Memory used: 0.003GB
PID: 23270; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_coverage.bed (23283)


Command completed. Elapsed time: 0:00:24. Running peak memory: 6.727GB.
PID: 23283; Command: bedtools; Return code: 0; Memory used: 0.01GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_coverage.bed (23323)


Command completed. Elapsed time: 0:00:28. Running peak memory: 6.727GB.
PID: 23323; Command: bedtools; Return code: 0; Memory used: 0.078GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.0091115)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_rpkm.bed (23375,23376,23377)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 23375; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 23377; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 23376; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.0091115)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_rpkm.bed (23380,23381,23382)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.727GB.
PID: 23380; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 23382; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 23381; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed (23384,23385,23386)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 23384; Command: join; Return code: 0; Memory used: 0.001GB
PID: 23386; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 23385; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.19 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed --annotate (23392)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.727GB.
PID: 23392; Command: Rscript; Return code: 0; Memory used: 0.319GB

mRNA contamination QC_hg38/H9_treated_PRO-seq_1_mRNA_contamination.pdf mRNA contamination QC_hg38/H9_treated_PRO-seq_1_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/QC_hg38/H9_treated_PRO-seq_1_exon_intron_ratios.bed (23420)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.727GB.
PID: 23420; Command: pigz; Return code: 0; Memory used: 0.005GB

Produce bigWig files (06-15 10:12:39) elapsed: 69.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam (23428)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.727GB.
PID: 23428; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18009111.5 (23437)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_plus.bam'
Temporary files will be stored in: 'tmp_H9_treated_PRO-seq_1_plus_cuttrace_mzrp_pq2'
Processing with 4 cores...
Discarding 109 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270711v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270720v1_random', 'chr22_KI270735v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_GL000214v1']
Keeping 86 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270752v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_exact_body_0-mer.bw'
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:18. Running peak memory: 6.727GB.
PID: 23437; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.785GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam (25650)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.727GB.
PID: 25650; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18009111.5 (25735)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/aligned_hg38/H9_treated_PRO-seq_1_minus.bam'
Temporary files will be stored in: 'tmp_H9_treated_PRO-seq_1_minus_cuttrace_evfj1ot8'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 106 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr17_KI270730v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1']
Keeping 89 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 89 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_exact_body_0-mer.bw'
Merging 89 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_1/signal_hg38/H9_treated_PRO-seq_1_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:17. Running peak memory: 6.727GB.
PID: 25735; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.731GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 3:10:12
  • Total elapsed time (all runs): 5:46:27
  • Peak memory (this run): 6.7273 GB
  • Pipeline completed time: 2020-06-15 10:27:30