Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name H9_treated_PRO-seq_2 --genome hg38 --input /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba27-28c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/
  • Pipeline started at: (06-15 07:17:18) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: H9_treated_PRO-seq_2
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE2.fastq.gz

File_mb 2737.32 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R1.fastq.gz (138709)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 138709; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/H9_200nM_romidepsin_rep2_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R2.fastq.gz (138712)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 138712; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1.fastq (138715)


Command completed. Elapsed time: 0:02:49. Running peak memory: 0.002GB.
PID: 138715; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2.fastq (45196)


Command completed. Elapsed time: 0:01:47. Running peak memory: 0.002GB.
PID: 45196; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 114083518 PEPPRO RES

Fastq_reads 114083518 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/H9_treated_PRO-seq_2_R2.fastq.gz']

FASTQ processing: (06-15 07:25:43) elapsed: 504.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_R1_cutadapt.txt (3602)


Command completed. Elapsed time: 0:02:40. Running peak memory: 3.232GB.
PID: 3602; Command: cutadapt; Return code: 0; Memory used: 3.232GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq (3786,3787)


Command completed. Elapsed time: 0:00:39. Running peak memory: 3.232GB.
PID: 3786; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 3787; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 28674037 PEPPRO RES

Trim_loss_rate 74.87 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq (3848)

Started analysis of H9_treated_PRO-seq_2_R1_processed.fastq
Approx 5% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 10% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 15% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 20% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 25% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 30% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 35% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 40% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 45% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 50% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 55% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 60% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 65% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 70% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 75% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 80% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 85% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 90% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 95% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 100% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Analysis complete for H9_treated_PRO-seq_2_R1_processed.fastq
Command completed. Elapsed time: 0:00:58. Running peak memory: 3.232GB.
PID: 3848; Command: fastqc; Return code: 0; Memory used: 0.182GB

FastQC report r1 fastqc/H9_treated_PRO-seq_2_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq (3943)

[INFO] 2388789 duplicated records removed
Command completed. Elapsed time: 0:01:04. Running peak memory: 3.232GB.
PID: 3943; Command: seqkit; Return code: 0; Memory used: 2.036GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq (4301,4302)


Command completed. Elapsed time: 0:00:37. Running peak memory: 3.232GB.
PID: 4301; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 4302; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 43984199.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 27614116.0 PEPPRO RES

Duplicate_reads 2388789.0 PEPPRO RES

Pct_uninformative_adapter_reads 48.4104 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/processed_R1.flag (4515)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.232GB.
PID: 4515; Command: touch; Return code: 0; Memory used: 0.0GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_R2_cutadapt.txt (4517)


Command completed. Elapsed time: 0:02:10. Running peak memory: 3.35GB.
PID: 4517; Command: cutadapt; Return code: 0; Memory used: 3.35GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq (4928,4929)


Command completed. Elapsed time: 0:00:47. Running peak memory: 3.35GB.
PID: 4928; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 4929; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 57348074 PEPPRO RES

Trim_loss_rate 49.73 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq (5021)

Started analysis of H9_treated_PRO-seq_2_R1_processed.fastq
Approx 5% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 10% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 15% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 20% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 25% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 30% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 35% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 40% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 45% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 50% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 55% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 60% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 65% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 70% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 75% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 80% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 85% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 90% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 95% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Approx 100% complete for H9_treated_PRO-seq_2_R1_processed.fastq
Analysis complete for H9_treated_PRO-seq_2_R1_processed.fastq
Command completed. Elapsed time: 0:00:59. Running peak memory: 3.35GB.
PID: 5021; Command: fastqc; Return code: 0; Memory used: 0.179GB

FastQC report r1 fastqc/H9_treated_PRO-seq_2_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq (5107)

Started analysis of H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 5% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 10% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 15% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 20% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 25% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 30% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 35% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 40% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 45% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 50% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 55% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 60% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 65% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 70% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 75% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 80% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 85% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 90% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Approx 95% complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Analysis complete for H9_treated_PRO-seq_2_R2_trimmed.fastq
Command completed. Elapsed time: 0:01:03. Running peak memory: 3.35GB.
PID: 5107; Command: fastqc; Return code: 0; Memory used: 0.17GB

FastQC report r2 fastqc/H9_treated_PRO-seq_2_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.histogram

fastq_pair -t 102675166 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq (5194)

Left paired: 29252476       Right paired: 29252476
Left single: 175167     Right single: 2238349
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:04:07. Running peak memory: 6.557GB.
PID: 5194; Command: fastq_pair; Return code: 0; Memory used: 6.557GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_noadap.fastq.paired.fq -o H9_treated_PRO-seq_2 -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt (5825)


Command completed. Elapsed time: 0:01:04. Running peak memory: 6.557GB.
PID: 5825; Command: flash; Return code: 0; Memory used: 0.117GB

Plot adapter insertion distribution (06-15 07:44:09) elapsed: 1106.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt -u 8 (6026)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.557GB.
PID: 6026; Command: Rscript; Return code: 0; Memory used: 0.204GB

Adapter insertion distribution cutadapt/H9_treated_PRO-seq_2_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/H9_treated_PRO-seq_2_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 20 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:44:15) elapsed: 6.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/cutadapt/H9_treated_PRO-seq_2.hist

Degradation_ratio 1.0037 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq (6203)


Command completed. Elapsed time: 0:00:34. Running peak memory: 6.557GB.
PID: 6203; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/processed_R2.flag (6234)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 6234; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/repaired.flag

fastq_pair -t 102675166 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq (6235)

Left paired: 28465823       Right paired: 28465823
Left single: 208214     Right single: 2295865
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:02:40. Running peak memory: 6.557GB.
PID: 6235; Command: fastq_pair; Return code: 0; Memory used: 5.268GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq (6592)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 6592; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq (6595)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 6595; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/repaired.flag (6596)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 6596; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/dups_repaired.flag

fastq_pair -t 102675166 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq (6597)

Left paired: 26273211       Right paired: 26273211
Left single: 141535     Right single: 4488477
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:02:34. Running peak memory: 6.557GB.
PID: 6597; Command: fastq_pair; Return code: 0; Memory used: 5.269GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq (7001)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 7001; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq (7003)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 7003; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/dups_repaired.flag (7004)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 7004; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 07:50:05) elapsed: 350.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:50:05) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_bt2 (7005)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 7005; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq (7006)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_treated_PRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 28465823 reads; of these: 28465823 (100.00%) were unpaired; of these: 25736513 (90.41%) aligned 0 times 2729310 (9.59%) aligned exactly 1 time 0 (0.00%) aligned >1 times 9.59% overall alignment rate

Aligned_reads_human_rDNA 5458620.0 PEPPRO RES

Alignment_rate_human_rDNA 9.52 PEPPRO RES

Map to human_rDNA (06-15 07:54:07) elapsed: 242.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_dups_bt2 (7278)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 7278; Command: mkfifo; Return code: 0; Memory used: 0.002GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_dups_R2.fq (7279)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id H9_treated_PRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/fastq/H9_treated_PRO-seq_2_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 2729310 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 07:57:59) elapsed: 231.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_treated_PRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/tmpj5bu8aqe -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam (7724,7725,7726)

2306063 reads skipped
0 reads lost
25736513 reads; of these:
  25736513 (100.00%) were paired; of these:
    10470203 (40.68%) aligned concordantly 0 times
    12826144 (49.84%) aligned concordantly exactly 1 time
    2440166 (9.48%) aligned concordantly >1 times
    ----
    10470203 pairs aligned concordantly 0 times; of these:
      2441340 (23.32%) aligned discordantly 1 time
    ----
    8028863 pairs aligned 0 times concordantly or discordantly; of these:
      16057726 mates make up the pairs; of these:
        6731776 (41.92%) aligned 0 times
        3441445 (21.43%) aligned exactly 1 time
        5884505 (36.65%) aligned >1 times
86.92% overall alignment rate
[bam_sort_core] merging from 15 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:49:01. Running peak memory: 6.557GB.
PID: 7724; Command: bowtie2; Return code: 0; Memory used: 3.778GB
PID: 7725; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 7726; Command: samtools; Return code: 0; Memory used: 0.906GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam (13046)


Command completed. Elapsed time: 0:01:33. Running peak memory: 6.557GB.
PID: 13046; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 44741250 PEPPRO RES

QC_filtered_reads 25860518 PEPPRO RES

Aligned_reads 18880731.5 PEPPRO RES

Alignment_rate 32.92 PEPPRO RES

Total_efficiency 16.55 PEPPRO RES

Read_depth 3.37 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id H9_treated_PRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/tmpj5bu8aqe -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp_dups.bam (14640,14642,14643)

23967148 reads; of these:
  23967148 (100.00%) were paired; of these:
    9441036 (39.39%) aligned concordantly 0 times
    12234981 (51.05%) aligned concordantly exactly 1 time
    2291131 (9.56%) aligned concordantly >1 times
    ----
    9441036 pairs aligned concordantly 0 times; of these:
      2335210 (24.73%) aligned discordantly 1 time
    ----
    7105826 pairs aligned 0 times concordantly or discordantly; of these:
      14211652 mates make up the pairs; of these:
        6043583 (42.53%) aligned 0 times
        3281410 (23.09%) aligned exactly 1 time
        4886659 (34.38%) aligned >1 times
87.39% overall alignment rate
[bam_sort_core] merging from 14 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:44:45. Running peak memory: 6.557GB.
PID: 14640; Command: bowtie2; Return code: 0; Memory used: 3.765GB
PID: 14642; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 14643; Command: samtools; Return code: 0; Memory used: 0.905GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam (19264)


Command completed. Elapsed time: 0:01:23. Running peak memory: 6.557GB.
PID: 19264; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 09:47:18) elapsed: 6560.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R1.fq (19418)


Command completed. Elapsed time: 0:00:23. Running peak memory: 6.557GB.
PID: 19418; Command: pigz; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/prealignments/H9_treated_PRO-seq_2_human_rDNA_unmap_R2.fq (19451)


Command completed. Elapsed time: 0:00:21. Running peak memory: 6.557GB.
PID: 19451; Command: pigz; Return code: 0; Memory used: 0.009GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam (19488)


Command completed. Elapsed time: 0:00:39. Running peak memory: 6.557GB.
PID: 19488; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 670904 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam (19546)


Command completed. Elapsed time: 0:00:32. Running peak memory: 6.557GB.
PID: 19546; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/chr_sizes.bed (19574,19575,19576,19577)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 19575; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 19577; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 19574; Command: samtools; Return code: 0; Memory used: 0.011GB
PID: 19576; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_noMT.bam (19579)


Command completed. Elapsed time: 0:00:46. Running peak memory: 6.557GB.
PID: 19579; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam (19690)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 19690; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam (19691)


Command completed. Elapsed time: 0:00:28. Running peak memory: 6.557GB.
PID: 19691; Command: samtools; Return code: 0; Memory used: 0.011GB

Split BAM file (06-15 09:50:28) elapsed: 190.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam (19978,19979)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:51. Running peak memory: 6.557GB.
PID: 19978; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 19979; Command: samtools; Return code: 0; Memory used: 5.526GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE2.bam (20253,20254)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:21. Running peak memory: 6.557GB.
PID: 20253; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 20254; Command: samtools; Return code: 0; Memory used: 4.484GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp_dups.bam (20756)


Command completed. Elapsed time: 0:00:35. Running peak memory: 6.557GB.
PID: 20756; Command: samtools; Return code: 0; Memory used: 0.01GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE1.bam (20791,20792)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:46. Running peak memory: 6.557GB.
PID: 20791; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 20792; Command: samtools; Return code: 0; Memory used: 5.349GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE2.bam (21036,21037)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:02:11. Running peak memory: 6.557GB.
PID: 21036; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 21037; Command: samtools; Return code: 0; Memory used: 4.334GB

Calculate library complexity (06-15 10:02:11) elapsed: 703.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE1.bam (21548)

BAM_INPUT
TOTAL READS     = 19595024
COUNTS_SUM      = 19595024
DISTINCT READS  = 1.48576e+07
DISTINCT COUNTS = 296
MAX COUNT       = 22664
COUNTS OF 1     = 1.29529e+07
OBSERVED COUNTS (22665)
1   12952887
2   1171763
3   313507
4   140501
5   77968
6   49441
7   32956
8   23332
9   17067
10  12863
11  9993
12  8220
13  6438
14  5374
15  4272
16  3535
17  3085
18  2617
19  2187
20  1897
21  1621
22  1418
23  1206
24  1109
25  972
26  869
27  788
28  680
29  637
30  560
31  514
32  459
33  411
34  377
35  353
36  323
37  323
38  279
39  249
40  227
41  222
42  223
43  172
44  153
45  195
46  137
47  127
48  127
49  119
50  121
51  114
52  120
53  100
54  84
55  90
56  84
57  60
58  80
59  77
60  77
61  68
62  80
63  66
64  44
65  54
66  49
67  32
68  53
69  48
70  41
71  32
72  39
73  32
74  29
75  29
76  27
77  31
78  22
79  29
80  27
81  31
82  32
83  33
84  21
85  27
86  21
87  8
88  19
89  15
90  15
91  12
92  20
93  18
94  14
95  14
96  21
97  8
98  16
99  9
100 15
101 8
102 13
103 19
104 13
105 14
106 6
107 11
108 12
109 13
110 10
111 8
112 13
113 7
114 9
115 3
116 11
117 9
118 10
119 5
120 5
121 7
122 4
123 9
124 6
125 9
126 4
127 6
128 7
129 6
130 8
131 3
132 7
133 8
134 7
135 3
136 7
137 5
138 8
139 5
140 10
141 4
142 3
143 3
144 4
145 2
146 2
147 7
148 4
149 4
150 3
151 3
153 4
154 2
155 6
156 2
157 3
158 4
160 5
161 2
162 2
163 1
164 1
165 1
166 6
167 3
168 1
169 5
170 1
171 5
172 4
173 1
174 4
175 5
176 1
177 4
178 1
179 4
180 2
181 4
183 1
184 4
185 6
188 1
189 2
190 1
191 1
194 1
195 2
196 3
197 3
198 2
199 1
200 1
202 2
203 4
206 2
207 1
208 2
209 1
211 1
212 1
213 3
214 3
216 2
217 1
221 1
222 2
224 1
225 1
227 1
228 1
231 2
234 4
236 1
237 1
240 1
242 2
246 1
247 1
250 2
253 1
254 1
255 1
256 1
257 1
259 1
260 1
263 3
265 1
266 1
267 1
268 2
273 1
274 1
277 1
279 1
280 1
282 2
283 1
286 1
287 1
288 1
290 1
292 1
295 3
297 1
301 1
305 1
309 1
321 1
334 1
338 1
343 1
346 1
360 1
364 1
366 1
380 1
382 1
388 1
389 1
398 1
401 1
409 1
410 1
433 1
450 1
484 1
485 1
492 1
498 1
501 1
502 1
558 1
607 1
609 1
643 1
718 1
762 1
781 1
850 1
863 1
932 1
1085    1
1090    1
1227    1
1252    1
1420    1
1536    1
1567    1
1836    1
5591    1
5743    1
7315    1
15219   1
22664   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 sample size: 19000000 Command completed. Elapsed time: 0:01:49. Running peak memory: 6.557GB.
PID: 21548; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE1.bam (21677)

BAM_INPUT
TOTAL READS     = 19595024
DISTINCT READS  = 1.48576e+07
DISTINCT COUNTS = 296
MAX COUNT       = 22664
COUNTS OF 1     = 1.29529e+07
MAX TERMS       = 100
OBSERVED COUNTS (22665)
1   12952887
2   1171763
3   313507
4   140501
5   77968
6   49441
7   32956
8   23332
9   17067
10  12863
11  9993
12  8220
13  6438
14  5374
15  4272
16  3535
17  3085
18  2617
19  2187
20  1897
21  1621
22  1418
23  1206
24  1109
25  972
26  869
27  788
28  680
29  637
30  560
31  514
32  459
33  411
34  377
35  353
36  323
37  323
38  279
39  249
40  227
41  222
42  223
43  172
44  153
45  195
46  137
47  127
48  127
49  119
50  121
51  114
52  120
53  100
54  84
55  90
56  84
57  60
58  80
59  77
60  77
61  68
62  80
63  66
64  44
65  54
66  49
67  32
68  53
69  48
70  41
71  32
72  39
73  32
74  29
75  29
76  27
77  31
78  22
79  29
80  27
81  31
82  32
83  33
84  21
85  27
86  21
87  8
88  19
89  15
90  15
91  12
92  20
93  18
94  14
95  14
96  21
97  8
98  16
99  9
100 15
101 8
102 13
103 19
104 13
105 14
106 6
107 11
108 12
109 13
110 10
111 8
112 13
113 7
114 9
115 3
116 11
117 9
118 10
119 5
120 5
121 7
122 4
123 9
124 6
125 9
126 4
127 6
128 7
129 6
130 8
131 3
132 7
133 8
134 7
135 3
136 7
137 5
138 8
139 5
140 10
141 4
142 3
143 3
144 4
145 2
146 2
147 7
148 4
149 4
150 3
151 3
153 4
154 2
155 6
156 2
157 3
158 4
160 5
161 2
162 2
163 1
164 1
165 1
166 6
167 3
168 1
169 5
170 1
171 5
172 4
173 1
174 4
175 5
176 1
177 4
178 1
179 4
180 2
181 4
183 1
184 4
185 6
188 1
189 2
190 1
191 1
194 1
195 2
196 3
197 3
198 2
199 1
200 1
202 2
203 4
206 2
207 1
208 2
209 1
211 1
212 1
213 3
214 3
216 2
217 1
221 1
222 2
224 1
225 1
227 1
228 1
231 2
234 4
236 1
237 1
240 1
242 2
246 1
247 1
250 2
253 1
254 1
255 1
256 1
257 1
259 1
260 1
263 3
265 1
266 1
267 1
268 2
273 1
274 1
277 1
279 1
280 1
282 2
283 1
286 1
287 1
288 1
290 1
292 1
295 3
297 1
301 1
305 1
309 1
321 1
334 1
338 1
343 1
346 1
360 1
364 1
366 1
380 1
382 1
388 1
389 1
398 1
401 1
409 1
410 1
433 1
450 1
484 1
485 1
492 1
498 1
501 1
502 1
558 1
607 1
609 1
643 1
718 1
762 1
781 1
850 1
863 1
932 1
1085    1
1090    1
1227    1
1252    1
1420    1
1536    1
1567    1
1836    1
5591    1
5743    1
7315    1
15219   1
22664   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] ..........................................................................._......................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:53. Running peak memory: 6.557GB.
PID: 21677; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_counts.txt (22125)


Command completed. Elapsed time: 0:00:29. Running peak memory: 6.557GB.
PID: 22125; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_plot (22230)

Processing H9_treated_PRO-seq_2
INFO: Found real counts for H9_treated_PRO-seq_2 - Total (M): 20.247016 Unique (M): 19.595024

Library complexity plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.557GB.
PID: 22230; Command: Rscript; Return code: 0; Memory used: 0.285GB

Library complexity QC_hg38/H9_treated_PRO-seq_2_preseq_plot.pdf Library complexity QC_hg38/H9_treated_PRO-seq_2_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.8189 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 10:06:27) elapsed: 256.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam (22265)


Command completed. Elapsed time: 0:00:16. Running peak memory: 6.557GB.
PID: 22265; Command: samtools; Return code: 0; Memory used: 0.014GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_bamQC.tsv (22287)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/tmp_H9_treated_PRO-seq_2_PE1_0_3why97'
Processing with 12 cores...
Discarding 98 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr5_GL000208v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270757v1']
Keeping 97 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270468v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270333v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270372v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:21. Running peak memory: 6.557GB.
PID: 22287; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.242GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 10123508.0 PEPPRO RES

PBC2 10123508.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_unmap.bam (22340)


Command completed. Elapsed time: 0:00:11. Running peak memory: 6.557GB.
PID: 22340; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_temp.bam

Unmapped_reads 6731776 PEPPRO RES

Split BAM by strand (06-15 10:07:22) elapsed: 55.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam (22402)


Command completed. Elapsed time: 0:01:08. Running peak memory: 6.557GB.
PID: 22402; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam (22482)


Command completed. Elapsed time: 0:01:07. Running peak memory: 6.557GB.
PID: 22482; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 10:09:36) elapsed: 134.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (22655)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 22655; Command: sed; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_plus_TssEnrichment.txt (22656)


Command completed. Elapsed time: 0:00:07. Running peak memory: 6.557GB.
PID: 22656; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.884GB

TSS_coding_score 57.4 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_minus_TssEnrichment.txt (22689)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.557GB.
PID: 22689; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.887GB

TSS_non-coding_score 16.5 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_minus_TssEnrichment.txt (22724)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 6.557GB.
PID: 22724; Command: Rscript; Return code: 0; Memory used: 0.316GB

TSS enrichment QC_hg38/H9_treated_PRO-seq_2_TSSenrichment.pdf TSS enrichment QC_hg38/H9_treated_PRO-seq_2_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt (22746,22747,22748,22749)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 22746; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 22748; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 22747; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 22749; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt (22751)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 22751; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 10:09:57) elapsed: 21.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_tss.bed (22753,22754)


Command completed. Elapsed time: 0:00:02. Running peak memory: 6.557GB.
PID: 22753; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 22754; Command: bedtools; Return code: 0; Memory used: 0.097GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed (22757,22758)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 22757; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 22758; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_TSS_density.bed (22761,22762,22763,22764)


Command completed. Elapsed time: 0:00:27. Running peak memory: 6.557GB.
PID: 22762; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 22764; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 22761; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 22763; Command: sort; Return code: 0; Memory used: 0.004GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_gene_body_density.bed (23067,23068,23069)


Command completed. Elapsed time: 0:00:31. Running peak memory: 6.557GB.
PID: 23068; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 23067; Command: bedtools; Return code: 0; Memory used: 0.058GB
PID: 23069; Command: sort; Return code: 0; Memory used: 0.003GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/tmpf0akdhol (23163,23164,23165)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23163; Command: join; Return code: 0; Memory used: 0.001GB
PID: 23165; Command: env; Return code: 0; Memory used: 0.006GB
PID: 23164; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/tmpf0akdhol | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0199168) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/tmpf0akdhol > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed (23172)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23172; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 59.52 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed (23177)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.557GB.
PID: 23177; Command: Rscript; Return code: 0; Memory used: 0.316GB

Pause index QC_hg38/H9_treated_PRO-seq_2_pause_index.pdf Pause index QC_hg38/H9_treated_PRO-seq_2_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_pause_index.bed (23204)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23204; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 10:11:02) elapsed: 66.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam 18880731.5 7474169

Plus_FRiP 0.4 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam 18880731.5 7075799

Minus_FRiP 0.37 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_gene_sort.bed (23276,23277)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23276; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 23277; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_gene_coverage.bed (23279)


Command completed. Elapsed time: 0:00:30. Running peak memory: 6.557GB.
PID: 23279; Command: bedtools; Return code: 0; Memory used: 0.061GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed.gz (23328)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23328; Command: ln; Return code: 0; Memory used: 0.0GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed (23329)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23329; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 10:12:09) elapsed: 67.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/raw/hg38_annotations.bed (23338)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23338; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer_sort.bed (23340,23341,23342,23343)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23340; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23341; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 23343; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 23342; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_plus_coverage.bed (23345)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23345; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_minus_coverage.bed (23359)


Command completed. Elapsed time: 0:00:12. Running peak memory: 6.557GB.
PID: 23359; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_sort.bed (23405,23406,23407,23408)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23405; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23406; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 23408; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 23407; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_plus_coverage.bed (23410)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.557GB.
PID: 23410; Command: bedtools; Return code: 0; Memory used: 0.014GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_minus_coverage.bed (23498)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.557GB.
PID: 23498; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region" (23519)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23519; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed (23520,23521,23522,23523)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23520; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23522; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 23521; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 23523; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed (23526)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23526; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed (23551)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23551; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR" (23590)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23590; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR_sort.bed (23591,23592,23593,23594)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23591; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23592; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 23594; Command: bedtools; Return code: 0; Memory used: 0.011GB
PID: 23593; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_plus_coverage.bed (23597)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23597; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_minus_coverage.bed (23629)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23629; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR" (23650)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 23650; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR_sort.bed (23652,23653,23654,23655)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23652; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23653; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 23655; Command: bedtools; Return code: 0; Memory used: 0.035GB
PID: 23654; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_plus_coverage.bed (23666)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23666; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_minus_coverage.bed (23696)


Command completed. Elapsed time: 0:00:13. Running peak memory: 6.557GB.
PID: 23696; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon_sort.bed (23720,23721,23722,23723)


Command completed. Elapsed time: 0:00:03. Running peak memory: 6.557GB.
PID: 23720; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23721; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 23723; Command: bedtools; Return code: 0; Memory used: 0.169GB
PID: 23722; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_plus_coverage.bed (23736)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.557GB.
PID: 23736; Command: bedtools; Return code: 0; Memory used: 0.023GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_minus_coverage.bed (23758)


Command completed. Elapsed time: 0:00:14. Running peak memory: 6.557GB.
PID: 23758; Command: bedtools; Return code: 0; Memory used: 0.017GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron_sort.bed (23791,23792,23793,23794)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 23791; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 23793; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 23792; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 23794; Command: bedtools; Return code: 0; Memory used: 0.086GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_plus_coverage.bed (23797)


Command completed. Elapsed time: 0:00:16. Running peak memory: 6.557GB.
PID: 23797; Command: bedtools; Return code: 0; Memory used: 0.081GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_minus_coverage.bed (24580)


Command completed. Elapsed time: 0:00:15. Running peak memory: 6.557GB.
PID: 24580; Command: bedtools; Return code: 0; Memory used: 0.039GB

Plot cFRiF/FRiF (06-15 10:15:29) elapsed: 200.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_treated_PRO-seq_2 -z 3099922541 -n 10264898 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_plus_coverage.bed (24620)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:37. Running peak memory: 6.557GB.
PID: 24620; Command: Rscript; Return code: 0; Memory used: 0.443GB

cFRiF QC_hg38/H9_treated_PRO-seq_2_cFRiF.pdf cFRiF QC_hg38/H9_treated_PRO-seq_2_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s H9_treated_PRO-seq_2 -z 3099922541 -n 10264898 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_Intron_plus_coverage.bed (24706)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:27. Running peak memory: 6.557GB.
PID: 24706; Command: Rscript; Return code: 0; Memory used: 0.451GB

FRiF QC_hg38/H9_treated_PRO-seq_2_FRiF.pdf FRiF QC_hg38/H9_treated_PRO-seq_2_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 10:16:34) elapsed: 65.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_exons_sort.bed (24751,24752)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.557GB.
PID: 24752; Command: bedtools; Return code: 0; Memory used: 0.094GB
PID: 24751; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_introns_sort.bed (24776,24777,24779)


Command completed. Elapsed time: 0:00:05. Running peak memory: 6.557GB.
PID: 24776; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 24779; Command: bedtools; Return code: 0; Memory used: 0.007GB
PID: 24777; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_coverage.bed (24789)


Command completed. Elapsed time: 0:00:26. Running peak memory: 6.557GB.
PID: 24789; Command: bedtools; Return code: 0; Memory used: 0.01GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_coverage.bed (24819)


Command completed. Elapsed time: 0:00:28. Running peak memory: 6.557GB.
PID: 24819; Command: bedtools; Return code: 0; Memory used: 0.08GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.8807315)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_rpkm.bed (24855,24856,24857)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 24855; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 24857; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 24856; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.8807315)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_rpkm.bed (24859,24860,24861)


Command completed. Elapsed time: 0:00:01. Running peak memory: 6.557GB.
PID: 24859; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 24861; Command: sort; Return code: 0; Memory used: 0.003GB
PID: 24860; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed (24864,24865,24866)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 24864; Command: join; Return code: 0; Memory used: 0.001GB
PID: 24866; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 24865; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.16 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed --annotate (24872)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 6.557GB.
PID: 24872; Command: Rscript; Return code: 0; Memory used: 0.302GB

mRNA contamination QC_hg38/H9_treated_PRO-seq_2_mRNA_contamination.pdf mRNA contamination QC_hg38/H9_treated_PRO-seq_2_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/QC_hg38/H9_treated_PRO-seq_2_exon_intron_ratios.bed (24893)


Command completed. Elapsed time: 0:00:00. Running peak memory: 6.557GB.
PID: 24893; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 10:17:45) elapsed: 71.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam (24901)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.557GB.
PID: 24901; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18880731.5 (24908)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_plus.bam'
Temporary files will be stored in: 'tmp_H9_treated_PRO-seq_2_plus_cuttrace_yuuf674x'
Processing with 4 cores...
stdin is empty of data
Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr5_GL000208v1_random', 'chr9_KI270720v1_random', 'chr14_KI270723v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1']
Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270468v1', 'chrUn_KI270519v1', 'chrUn_KI270589v1', 'chrUn_KI270372v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_exact_body_0-mer.bw'
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:24. Running peak memory: 6.557GB.
PID: 24908; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.724GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam (28151)


Command completed. Elapsed time: 0:00:08. Running peak memory: 6.557GB.
PID: 28151; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 18880731.5 (28158)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/aligned_hg38/H9_treated_PRO-seq_2_minus.bam'
Temporary files will be stored in: 'tmp_H9_treated_PRO-seq_2_minus_cuttrace_w7kmqi2c'
Processing with 4 cores...
Discarding 103 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr22_KI270736v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270757v1']
Keeping 92 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270333v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 92 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_exact_body_0-mer.bw'
Merging 92 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/H9_treated_PRO-seq_2/signal_hg38/H9_treated_PRO-seq_2_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:16. Running peak memory: 6.557GB.
PID: 28158; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.65GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 3:15:23
  • Total elapsed time (all runs): 5:47:25
  • Peak memory (this run): 6.5575 GB
  • Pipeline completed time: 2020-06-15 10:32:41