FastQCFastQC Report
Thu 27 Feb 2020
H9_treated_PRO-seq_2_R1_processed.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameH9_treated_PRO-seq_2_R1_processed.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences28674037
Sequences flagged as poor quality0
Sequence length10-38
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNN3628391.2653921036650682No Hit
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2376020.8286311411260298No Hit
GGCACCCGAGAATTCCA1270370.44303841834339547Illumina Small RNA Adapter 2 (100% over 17bp)
GCACCCGAGAATTCCA749660.2614420843496854Illumina Small RNA Adapter 2 (100% over 16bp)
CGAGAATTCCA552080.19253654447052573Illumina Small RNA Adapter 2 (100% over 11bp)
CCGAGAATTCCA491590.17144080549243904Illumina Small RNA Adapter 2 (100% over 12bp)
TTGAAAGTCAGCCCTCGACACAAGGGTTTGT478680.16693847469053624No Hit
ACCCGAGAATTCCA468560.16340914953830882Illumina Small RNA Adapter 2 (100% over 14bp)
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTA363880.12690225656052548No Hit
CCCGAGAATTCCA294350.10265383977847277Illumina Small RNA Adapter 2 (100% over 13bp)

[OK]Adapter Content

Adapter graph