Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name HEK_ARF_PRO-seq --genome hg38 --input /project/shefflab/data//guertin/fastq/SRR8608070_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/SRR8608070_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-32c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/
  • Pipeline started at: (06-15 07:17:12) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/SRR8608070_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/SRR8608070_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: HEK_ARF_PRO-seq
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/SRR8608070_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/SRR8608070_PE2.fastq.gz

File_mb 1302.45 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/SRR8608070_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R1.fastq.gz (380686)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380686; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/SRR8608070_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R2.fastq.gz (380688)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380688; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1.fastq (380695)


Command completed. Elapsed time: 0:01:44. Running peak memory: 0.002GB.
PID: 380695; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2.fastq (380797)


Command completed. Elapsed time: 0:00:59. Running peak memory: 0.002GB.
PID: 380797; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 53049272 PEPPRO RES

Fastq_reads 53049272 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/HEK_ARF_PRO-seq_R2.fastq.gz']

FASTQ processing: (06-15 07:20:17) elapsed: 184.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_R1_cutadapt.txt (381168)


Command completed. Elapsed time: 0:00:39. Running peak memory: 1.701GB.
PID: 381168; Command: cutadapt; Return code: 0; Memory used: 1.701GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq (381268,381269)


Command completed. Elapsed time: 0:00:21. Running peak memory: 1.701GB.
PID: 381268; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381269; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 16312692 PEPPRO RES

Trim_loss_rate 69.25 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq (381301)

Started analysis of HEK_ARF_PRO-seq_R1_processed.fastq
Approx 5% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 10% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 15% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 20% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 25% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 30% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 35% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 40% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 45% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 50% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 55% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 60% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 65% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 70% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 75% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 80% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 85% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 90% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 95% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Analysis complete for HEK_ARF_PRO-seq_R1_processed.fastq
Command completed. Elapsed time: 0:00:30. Running peak memory: 1.701GB.
PID: 381301; Command: fastqc; Return code: 0; Memory used: 0.157GB

FastQC report r1 fastqc/HEK_ARF_PRO-seq_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq (381396)

[INFO] 778059 duplicated records removed
Command completed. Elapsed time: 0:00:24. Running peak memory: 1.701GB.
PID: 381396; Command: seqkit; Return code: 0; Memory used: 1.025GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq (381446,381448)


Command completed. Elapsed time: 0:00:16. Running peak memory: 1.701GB.
PID: 381446; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381448; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 21262101.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 8863359.0 PEPPRO RES

Duplicate_reads 778059.0 PEPPRO RES

Pct_uninformative_adapter_reads 33.4156 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/processed_R1.flag (381525)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.701GB.
PID: 381525; Command: touch; Return code: 0; Memory used: 0.002GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_R2_cutadapt.txt (381527)


Command completed. Elapsed time: 0:01:01. Running peak memory: 2.006GB.
PID: 381527; Command: cutadapt; Return code: 0; Memory used: 2.006GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq (381659,381660)


Command completed. Elapsed time: 0:00:23. Running peak memory: 2.006GB.
PID: 381659; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381660; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 32625384 PEPPRO RES

Trim_loss_rate 38.5 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq (381709)

Started analysis of HEK_ARF_PRO-seq_R1_processed.fastq
Approx 5% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 10% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 15% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 20% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 25% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 30% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 35% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 40% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 45% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 50% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 55% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 60% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 65% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 70% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 75% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 80% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 85% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 90% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Approx 95% complete for HEK_ARF_PRO-seq_R1_processed.fastq
Analysis complete for HEK_ARF_PRO-seq_R1_processed.fastq
Command completed. Elapsed time: 0:00:30. Running peak memory: 2.006GB.
PID: 381709; Command: fastqc; Return code: 0; Memory used: 0.158GB

FastQC report r1 fastqc/HEK_ARF_PRO-seq_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq (381948)

Started analysis of HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 5% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 10% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 15% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 20% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 25% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 30% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 35% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 40% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 45% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 50% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 55% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 60% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 65% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 70% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 75% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 80% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 85% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 90% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Approx 95% complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Analysis complete for HEK_ARF_PRO-seq_R2_trimmed.fastq
Command completed. Elapsed time: 0:00:33. Running peak memory: 2.006GB.
PID: 381948; Command: fastqc; Return code: 0; Memory used: 0.151GB

FastQC report r2 fastqc/HEK_ARF_PRO-seq_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.histogram

fastq_pair -t 47744344 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq (382028)

Left paired: 17619354       Right paired: 17619354
Left single: 41924      Right single: 1037248
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:00:58. Running peak memory: 2.777GB.
PID: 382028; Command: fastq_pair; Return code: 0; Memory used: 2.777GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_noadap.fastq.paired.fq -o HEK_ARF_PRO-seq -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt (382093)


Command completed. Elapsed time: 0:00:28. Running peak memory: 2.777GB.
PID: 382093; Command: flash; Return code: 0; Memory used: 0.12GB

Plot adapter insertion distribution (06-15 07:27:26) elapsed: 429.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt -u 8 (382268)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 2.777GB.
PID: 382268; Command: Rscript; Return code: 0; Memory used: 0.21GB

Adapter insertion distribution cutadapt/HEK_ARF_PRO-seq_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/HEK_ARF_PRO-seq_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 17 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:27:32) elapsed: 6.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/cutadapt/HEK_ARF_PRO-seq.hist

Degradation_ratio 1.349 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq (382298)


Command completed. Elapsed time: 0:00:12. Running peak memory: 2.777GB.
PID: 382298; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/processed_R2.flag (382334)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382334; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/repaired.flag

fastq_pair -t 47744344 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq (382335)

Left paired: 16265754       Right paired: 16265754
Left single: 46939      Right single: 1128770
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:01:01. Running peak memory: 2.777GB.
PID: 382335; Command: fastq_pair; Return code: 0; Memory used: 1.579GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq (382481)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382481; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq (382538)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382538; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/repaired.flag (382539)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382539; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/dups_repaired.flag

fastq_pair -t 47744344 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq (382540)

Left paired: 15570095       Right paired: 15570095
Left single: 33539      Right single: 1824429
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:01:05. Running peak memory: 2.777GB.
PID: 382540; Command: fastq_pair; Return code: 0; Memory used: 2.327GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq (382623)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382623; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq (382624)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382624; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/dups_repaired.flag (382625)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382625; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 07:29:52) elapsed: 140.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:29:52) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_bt2 (382627)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 382627; Command: mkfifo; Return code: 0; Memory used: 0.001GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq (382629)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id HEK_ARF_PRO-seq -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 16265754 reads; of these: 16265754 (100.00%) were unpaired; of these: 14454678 (88.87%) aligned 0 times 1811076 (11.13%) aligned exactly 1 time 0 (0.00%) aligned >1 times 11.13% overall alignment rate

Aligned_reads_human_rDNA 3622152.0 PEPPRO RES

Alignment_rate_human_rDNA 11.1 PEPPRO RES

Map to human_rDNA (06-15 07:31:33) elapsed: 101.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_dups_bt2 (383010)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.777GB.
PID: 383010; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_dups_R2.fq (383011)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id HEK_ARF_PRO-seq -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/fastq/HEK_ARF_PRO-seq_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 1811076 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 07:33:11) elapsed: 98.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id HEK_ARF_PRO-seq -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/tmpyxgj3zkp -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam (383176,383177,383178)

1573721 reads skipped
0 reads lost
14454678 reads; of these:
  14454678 (100.00%) were paired; of these:
    7643921 (52.88%) aligned concordantly 0 times
    5500043 (38.05%) aligned concordantly exactly 1 time
    1310714 (9.07%) aligned concordantly >1 times
    ----
    7643921 pairs aligned concordantly 0 times; of these:
      1654946 (21.65%) aligned discordantly 1 time
    ----
    5988975 pairs aligned 0 times concordantly or discordantly; of these:
      11977950 mates make up the pairs; of these:
        3997391 (33.37%) aligned 0 times
        2623537 (21.90%) aligned exactly 1 time
        5357022 (44.72%) aligned >1 times
86.17% overall alignment rate
[bam_sort_core] merging from 7 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:27:30. Running peak memory: 3.763GB.
PID: 383176; Command: bowtie2; Return code: 0; Memory used: 3.763GB
PID: 383177; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 383178; Command: samtools; Return code: 0; Memory used: 0.91GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam (386037)


Command completed. Elapsed time: 0:00:52. Running peak memory: 3.763GB.
PID: 386037; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 24911965 PEPPRO RES

QC_filtered_reads 15309473 PEPPRO RES

Aligned_reads 9602492.0 PEPPRO RES

Alignment_rate 29.43 PEPPRO RES

Total_efficiency 18.1 PEPPRO RES

Read_depth 2.05 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id HEK_ARF_PRO-seq -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/tmpyxgj3zkp -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp_dups.bam (387068,387074,387075)

13996374 reads; of these:
  13996374 (100.00%) were paired; of these:
    7372007 (52.67%) aligned concordantly 0 times
    5351994 (38.24%) aligned concordantly exactly 1 time
    1272373 (9.09%) aligned concordantly >1 times
    ----
    7372007 pairs aligned concordantly 0 times; of these:
      1611786 (21.86%) aligned discordantly 1 time
    ----
    5760221 pairs aligned 0 times concordantly or discordantly; of these:
      11520442 mates make up the pairs; of these:
        3875941 (33.64%) aligned 0 times
        2545638 (22.10%) aligned exactly 1 time
        5098863 (44.26%) aligned >1 times
86.15% overall alignment rate
[bam_sort_core] merging from 7 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:26:14. Running peak memory: 3.763GB.
PID: 387068; Command: bowtie2; Return code: 0; Memory used: 3.758GB
PID: 387074; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 387075; Command: samtools; Return code: 0; Memory used: 0.908GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam (390140)


Command completed. Elapsed time: 0:00:53. Running peak memory: 3.763GB.
PID: 390140; Command: samtools; Return code: 0; Memory used: 0.022GB

Compress all unmapped read files (06-15 08:38:21) elapsed: 3910.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R2.fq (390199)


Command completed. Elapsed time: 0:00:12. Running peak memory: 3.763GB.
PID: 390199; Command: pigz; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/prealignments/HEK_ARF_PRO-seq_human_rDNA_unmap_R1.fq (390223)


Command completed. Elapsed time: 0:00:13. Running peak memory: 3.763GB.
PID: 390223; Command: pigz; Return code: 0; Memory used: 0.013GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam (390251)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.763GB.
PID: 390251; Command: samtools; Return code: 0; Memory used: 0.015GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 252493 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam (390271)


Command completed. Elapsed time: 0:00:13. Running peak memory: 3.763GB.
PID: 390271; Command: samtools; Return code: 0; Memory used: 0.008GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/chr_sizes.bed (390283,390284,390285,390286)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 390284; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 390286; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 390283; Command: samtools; Return code: 0; Memory used: 0.009GB
PID: 390285; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_noMT.bam (390288)


Command completed. Elapsed time: 0:00:18. Running peak memory: 3.763GB.
PID: 390288; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam (390321)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 390321; Command: mv; Return code: 0; Memory used: 0.001GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam (390323)


Command completed. Elapsed time: 0:00:14. Running peak memory: 3.763GB.
PID: 390323; Command: samtools; Return code: 0; Memory used: 0.008GB

Split BAM file (06-15 08:39:51) elapsed: 90.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam (390337,390338)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:15. Running peak memory: 3.763GB.
PID: 390338; Command: samtools; Return code: 0; Memory used: 2.324GB
PID: 390337; Command: samtools; Return code: 0; Memory used: 0.004GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE2.bam (390777,390778)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:00:59. Running peak memory: 3.763GB.
PID: 390777; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 390778; Command: samtools; Return code: 0; Memory used: 1.903GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp_dups.bam (390903)


Command completed. Elapsed time: 0:00:19. Running peak memory: 3.763GB.
PID: 390903; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE1.bam (390926,390927)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:15. Running peak memory: 3.763GB.
PID: 390927; Command: samtools; Return code: 0; Memory used: 2.278GB
PID: 390926; Command: samtools; Return code: 0; Memory used: 0.004GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE2.bam (391029,391031)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:00:59. Running peak memory: 3.763GB.
PID: 391029; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 391031; Command: samtools; Return code: 0; Memory used: 1.902GB

Calculate library complexity (06-15 08:45:10) elapsed: 319.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE1.bam (391411)

BAM_INPUT
TOTAL READS     = 10681803
COUNTS_SUM      = 10681803
DISTINCT READS  = 9.74978e+06
DISTINCT COUNTS = 191
MAX COUNT       = 10729
COUNTS OF 1     = 9.18474e+06
OBSERVED COUNTS (10730)
1   9184735
2   448142
3   68359
4   20973
5   9240
6   4893
7   3018
8   2018
9   1466
10  1033
11  789
12  698
13  515
14  446
15  342
16  284
17  260
18  236
19  196
20  182
21  148
22  130
23  109
24  104
25  91
26  87
27  79
28  83
29  71
30  56
31  63
32  59
33  34
34  38
35  37
36  30
37  37
38  36
39  29
40  25
41  24
42  30
43  20
44  13
45  16
46  22
47  13
48  24
49  21
50  7
51  10
52  12
53  13
54  9
55  14
56  7
57  12
58  13
59  10
60  12
61  11
62  6
63  5
64  11
65  9
66  5
67  2
68  6
69  5
70  5
71  2
72  6
73  9
74  7
75  5
76  4
77  4
78  3
79  8
80  1
81  2
82  4
83  11
84  2
85  6
86  3
87  3
88  3
89  6
90  1
91  3
93  1
94  4
95  4
96  1
97  1
98  1
99  3
100 2
102 2
103 2
104 2
105 6
106 3
107 1
108 3
109 2
110 3
112 1
113 3
114 4
115 1
117 1
118 1
119 2
120 5
121 1
122 2
124 1
125 2
126 1
127 1
128 3
129 2
133 1
134 1
135 2
138 1
139 3
140 2
142 1
147 1
148 1
153 2
154 1
157 1
159 1
160 1
161 2
162 1
166 1
172 1
173 1
175 1
177 1
182 1
184 1
185 1
186 1
187 1
188 1
192 1
193 1
196 1
198 1
206 1
212 1
216 1
219 1
223 1
233 1
236 1
248 2
267 1
271 1
280 1
286 1
326 1
346 1
351 1
360 1
364 1
396 1
420 1
431 1
461 1
485 1
511 1
536 1
617 1
667 1
771 1
893 1
927 1
974 1
1194    1
1354    1
3429    1
4692    1
7862    1
10729   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 Command completed. Elapsed time: 0:00:57. Running peak memory: 3.763GB.
PID: 391411; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE1.bam (391464)

BAM_INPUT
TOTAL READS     = 10681803
DISTINCT READS  = 9.74978e+06
DISTINCT COUNTS = 191
MAX COUNT       = 10729
COUNTS OF 1     = 9.18474e+06
MAX TERMS       = 90
OBSERVED COUNTS (10730)
1   9184735
2   448142
3   68359
4   20973
5   9240
6   4893
7   3018
8   2018
9   1466
10  1033
11  789
12  698
13  515
14  446
15  342
16  284
17  260
18  236
19  196
20  182
21  148
22  130
23  109
24  104
25  91
26  87
27  79
28  83
29  71
30  56
31  63
32  59
33  34
34  38
35  37
36  30
37  37
38  36
39  29
40  25
41  24
42  30
43  20
44  13
45  16
46  22
47  13
48  24
49  21
50  7
51  10
52  12
53  13
54  9
55  14
56  7
57  12
58  13
59  10
60  12
61  11
62  6
63  5
64  11
65  9
66  5
67  2
68  6
69  5
70  5
71  2
72  6
73  9
74  7
75  5
76  4
77  4
78  3
79  8
80  1
81  2
82  4
83  11
84  2
85  6
86  3
87  3
88  3
89  6
90  1
91  3
93  1
94  4
95  4
96  1
97  1
98  1
99  3
100 2
102 2
103 2
104 2
105 6
106 3
107 1
108 3
109 2
110 3
112 1
113 3
114 4
115 1
117 1
118 1
119 2
120 5
121 1
122 2
124 1
125 2
126 1
127 1
128 3
129 2
133 1
134 1
135 2
138 1
139 3
140 2
142 1
147 1
148 1
153 2
154 1
157 1
159 1
160 1
161 2
162 1
166 1
172 1
173 1
175 1
177 1
182 1
184 1
185 1
186 1
187 1
188 1
192 1
193 1
196 1
198 1
206 1
212 1
216 1
219 1
223 1
233 1
236 1
248 2
267 1
271 1
280 1
286 1
326 1
346 1
351 1
360 1
364 1
396 1
420 1
431 1
461 1
485 1
511 1
536 1
617 1
667 1
771 1
893 1
927 1
974 1
1194    1
1354    1
3429    1
4692    1
7862    1
10729   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] ..................................................................................._................. [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:00. Running peak memory: 3.763GB.
PID: 391464; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_counts.txt (391557)


Command completed. Elapsed time: 0:00:15. Running peak memory: 3.763GB.
PID: 391557; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_plot (391575)

Processing HEK_ARF_PRO-seq
INFO: Found real counts for HEK_ARF_PRO-seq - Total (M): 10.869678 Unique (M): 10.681803

Library complexity plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.763GB.
PID: 391575; Command: Rscript; Return code: 0; Memory used: 0.316GB

Library complexity QC_hg38/HEK_ARF_PRO-seq_preseq_plot.pdf Library complexity QC_hg38/HEK_ARF_PRO-seq_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.9164 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 08:47:25) elapsed: 136.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam (391600)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.763GB.
PID: 391600; Command: samtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_bamQC.tsv (391608)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/tmp_HEK_ARF_PRO-seq_PE1_hha_ji71'
Processing with 12 cores...
Discarding 96 chunk(s) of reads: ['chrM', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr22_KI270732v1_random', 'chr22_KI270737v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270757v1']
Keeping 99 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270508v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:13. Running peak memory: 3.763GB.
PID: 391608; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.11GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 5434839.0 PEPPRO RES

PBC2 5434839.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_unmap.bam (391648)


Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 391648; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_temp.bam

Unmapped_reads 3997391 PEPPRO RES

Split BAM by strand (06-15 08:47:55) elapsed: 30.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam (391685)


Command completed. Elapsed time: 0:00:34. Running peak memory: 3.763GB.
PID: 391685; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam (391720)


Command completed. Elapsed time: 0:00:34. Running peak memory: 3.763GB.
PID: 391720; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 08:49:03) elapsed: 68.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (391767)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391767; Command: sed; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_plus_TssEnrichment.txt (391768)


Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 391768; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.94GB

TSS_coding_score 18.5 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_minus_TssEnrichment.txt (391799)


Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 391799; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.989GB

TSS_non-coding_score 2.4 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_minus_TssEnrichment.txt (391829)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 3.763GB.
PID: 391829; Command: Rscript; Return code: 0; Memory used: 0.316GB

TSS enrichment QC_hg38/HEK_ARF_PRO-seq_TSSenrichment.pdf TSS enrichment QC_hg38/HEK_ARF_PRO-seq_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt (391851,391852,391853,391854)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391851; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 391853; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 391852; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 391854; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt (391856)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391856; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 08:49:18) elapsed: 15.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_tss.bed (391860,391861)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.763GB.
PID: 391860; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 391861; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed (391865,391866)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391865; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 391866; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_TSS_density.bed (391868,391869,391870,391871)


Command completed. Elapsed time: 0:00:15. Running peak memory: 3.763GB.
PID: 391871; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 391868; Command: bedtools; Return code: 0; Memory used: 0.005GB
PID: 391870; Command: sort; Return code: 0; Memory used: 0.008GB
PID: 391869; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_gene_body_density.bed (391885,391886,391887)


Command completed. Elapsed time: 0:00:16. Running peak memory: 3.763GB.
PID: 391885; Command: bedtools; Return code: 0; Memory used: 0.046GB
PID: 391887; Command: sort; Return code: 0; Memory used: 0.009GB
PID: 391886; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/tmplde2mrc0 (391909,391910,391911)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391909; Command: join; Return code: 0; Memory used: 0.001GB
PID: 391911; Command: env; Return code: 0; Memory used: 0.004GB
PID: 391910; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/tmplde2mrc0 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0100944) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/tmplde2mrc0 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed (391917)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391917; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 11.57 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed (391922)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.763GB.
PID: 391922; Command: Rscript; Return code: 0; Memory used: 0.32GB

Pause index QC_hg38/HEK_ARF_PRO-seq_pause_index.pdf Pause index QC_hg38/HEK_ARF_PRO-seq_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_pause_index.bed (391945)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 391945; Command: pigz; Return code: 0; Memory used: 0.003GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 08:49:56) elapsed: 39.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam 9602492.0 4000690

Plus_FRiP 0.42 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam 9602492.0 3788384

Minus_FRiP 0.39 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_gene_sort.bed (392247,392248)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392247; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 392248; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_gene_coverage.bed (392251)


Command completed. Elapsed time: 0:00:17. Running peak memory: 3.763GB.
PID: 392251; Command: bedtools; Return code: 0; Memory used: 0.046GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed.gz (392274)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392274; Command: ln; Return code: 0; Memory used: 0.0GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed (392275)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392275; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 08:50:35) elapsed: 38.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/raw/hg38_annotations.bed (392283)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392283; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer_sort.bed (392286,392287,392288,392289)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392286; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392287; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392289; Command: bedtools; Return code: 0; Memory used: 0.013GB
PID: 392288; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_plus_coverage.bed (392291)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392291; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_minus_coverage.bed (392299)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392299; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_sort.bed (392308,392309,392310,392311)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392308; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392309; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392311; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 392310; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_plus_coverage.bed (392313)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392313; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_minus_coverage.bed (392321)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392321; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region" (392328)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392328; Command: mv; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed (392329,392330,392331,392332)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392329; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392331; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392330; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392332; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed (392335)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392335; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_minus_coverage.bed (392352)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392352; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR" (392360)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392360; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR_sort.bed (392361,392362,392363,392364)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392361; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392362; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392364; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 392363; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_plus_coverage.bed (392367)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392367; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_minus_coverage.bed (392374)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392374; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR" (392384)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392384; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR_sort.bed (392385,392386,392387,392388)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392385; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392386; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392388; Command: bedtools; Return code: 0; Memory used: 0.011GB
PID: 392387; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_plus_coverage.bed (392390)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392390; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_minus_coverage.bed (392398)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.763GB.
PID: 392398; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon_sort.bed (392405,392406,392407,392408)


Command completed. Elapsed time: 0:00:03. Running peak memory: 3.763GB.
PID: 392405; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392406; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 392408; Command: bedtools; Return code: 0; Memory used: 0.164GB
PID: 392407; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_plus_coverage.bed (392413)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.763GB.
PID: 392413; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_minus_coverage.bed (392429)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.763GB.
PID: 392429; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron_sort.bed (392437,392438,392439,392440)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392437; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392439; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392438; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392440; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_plus_coverage.bed (392443)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.763GB.
PID: 392443; Command: bedtools; Return code: 0; Memory used: 0.017GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_minus_coverage.bed (392454)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.763GB.
PID: 392454; Command: bedtools; Return code: 0; Memory used: 0.019GB

Plot cFRiF/FRiF (06-15 08:52:25) elapsed: 111.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s HEK_ARF_PRO-seq -z 3099922541 -n 5523870 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_plus_coverage.bed (392479)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:38. Running peak memory: 3.763GB.
PID: 392479; Command: Rscript; Return code: 0; Memory used: 0.45GB

cFRiF QC_hg38/HEK_ARF_PRO-seq_cFRiF.pdf cFRiF QC_hg38/HEK_ARF_PRO-seq_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s HEK_ARF_PRO-seq -z 3099922541 -n 5523870 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_Intron_plus_coverage.bed (392532)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:27. Running peak memory: 3.763GB.
PID: 392532; Command: Rscript; Return code: 0; Memory used: 0.467GB

FRiF QC_hg38/HEK_ARF_PRO-seq_FRiF.pdf FRiF QC_hg38/HEK_ARF_PRO-seq_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 08:53:31) elapsed: 65.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_exons_sort.bed (392576,392577)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.763GB.
PID: 392577; Command: bedtools; Return code: 0; Memory used: 0.094GB
PID: 392576; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_introns_sort.bed (392584,392585,392586)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.763GB.
PID: 392584; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 392586; Command: bedtools; Return code: 0; Memory used: 0.006GB
PID: 392585; Command: bedtools; Return code: 0; Memory used: 0.035GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_coverage.bed (392593)


Command completed. Elapsed time: 0:00:13. Running peak memory: 3.763GB.
PID: 392593; Command: bedtools; Return code: 0; Memory used: 0.009GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_coverage.bed (392608)


Command completed. Elapsed time: 0:00:15. Running peak memory: 3.763GB.
PID: 392608; Command: bedtools; Return code: 0; Memory used: 0.038GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/9.602492)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_rpkm.bed (392647,392648,392649)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392647; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 392649; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 392648; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/9.602492)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_rpkm.bed (392651,392652,392653)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.763GB.
PID: 392651; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 392653; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 392652; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed (392656,392657,392658)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392656; Command: join; Return code: 0; Memory used: 0.001GB
PID: 392658; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 392657; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.29 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed --annotate (392664)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 392664; Command: Rscript; Return code: 0; Memory used: 0.321GB

mRNA contamination QC_hg38/HEK_ARF_PRO-seq_mRNA_contamination.pdf mRNA contamination QC_hg38/HEK_ARF_PRO-seq_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/QC_hg38/HEK_ARF_PRO-seq_exon_intron_ratios.bed (392684)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.763GB.
PID: 392684; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 08:54:16) elapsed: 45.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam (392693)


Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 392693; Command: samtools; Return code: 0; Memory used: 0.015GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 9602492.0 (392697)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_plus.bam'
Temporary files will be stored in: 'tmp_HEK_ARF_PRO-seq_plus_cuttrace_oij6c0gj'
Processing with 4 cores...
Discarding 113 chunk(s) of reads: ['chrM', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr22_KI270732v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270752v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1']
Keeping 82 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270710v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270589v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 82 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_exact_body_0-mer.bw'
Merging 82 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:14. Running peak memory: 3.763GB.
PID: 392697; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.417GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam (395252)


Command completed. Elapsed time: 0:00:04. Running peak memory: 3.763GB.
PID: 395252; Command: samtools; Return code: 0; Memory used: 0.015GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 9602492.0 (395256)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/aligned_hg38/HEK_ARF_PRO-seq_minus.bam'
Temporary files will be stored in: 'tmp_HEK_ARF_PRO-seq_minus_cuttrace_6_trlrs6'
Processing with 4 cores...
stdin is empty of data
Discarding 107 chunk(s) of reads: ['chrM', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270720v1_random', 'chr14_KI270722v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr22_KI270732v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1']
Keeping 88 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270508v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270589v1', 'chrUn_KI270330v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 88 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_exact_body_0-mer.bw'
Merging 88 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_ARF_PRO-seq/signal_hg38/HEK_ARF_PRO-seq_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:07. Running peak memory: 3.763GB.
PID: 395256; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.43GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 1:51:34
  • Total elapsed time (all runs): 3:19:56
  • Peak memory (this run): 3.7633 GB
  • Pipeline completed time: 2020-06-15 09:08:46