FastQCFastQC Report
Thu 27 Feb 2020
HEK_ARF_PRO-seq_R1_processed.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameHEK_ARF_PRO-seq_R1_processed.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16312692
Sequences flagged as poor quality0
Sequence length10-38
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2045301.2538089973132576No Hit
GGCACCCGAGAATTCCA437990.26849645662408145Illumina Small RNA Adapter 2 (100% over 17bp)
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC302630.185518122943779No Hit
TTGAAAGTCAGCCCTCGACACAAGGGTTTGT290600.17814349710029465No Hit
GCACCCGAGAATTCCA256840.15744795524858804Illumina Small RNA Adapter 2 (100% over 16bp)
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTA178610.10949143157977849No Hit

[OK]Adapter Content

Adapter graph