FastQCFastQC Report
Thu 27 Feb 2020
HEK_ARF_PRO-seq_R2_trimmed.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameHEK_ARF_PRO-seq_R2_trimmed.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17394524
Sequences flagged as poor quality0
Sequence length10-30
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNN4767972.7410752947306865No Hit
CCCCCCCCCCCCCCCCCCCCCCCCCCCCC4117842.367319738096886No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTT681230.39163474665935094No Hit
ATTCTCGGGTGCCAAGGTGGAATTCTCGGG456340.26234693171253204No Hit
CGCGGGCCCAGAAGCGCAGCGACAGCCTC186330.107119918889416No Hit

[OK]Adapter Content

Adapter graph