Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name HEK_PRO-seq --genome hg38 --input /project/shefflab/data//guertin/fastq/SRR8608074_PE1.fastq.gz --single-or-paired PAIRED -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --input2 /project/shefflab/data//guertin/fastq/SRR8608074_PE2.fastq.gz --protocol PRO --umi-len 8 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-32c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/
  • Pipeline started at: (06-15 07:17:12) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/SRR8608074_PE1.fastq.gz']
  • input2: ['/project/shefflab/data//guertin/fastq/SRR8608074_PE2.fastq.gz']
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: True
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: HEK_PRO-seq
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: PAIRED
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 8
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/SRR8608074_PE1.fastq.gz Local input file: /project/shefflab/data//guertin/fastq/SRR8608074_PE2.fastq.gz

File_mb 1337.94 PEPPRO RES

Read_type PAIRED PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R1.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/SRR8608074_PE1.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R1.fastq.gz (380687)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380687; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R1.fastq.gz' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R2.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/SRR8608074_PE2.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R2.fastq.gz (380691)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380691; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R2.fastq.gz' Found .fastq.gz file Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1.fastq,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1.fastq (380697)


Command completed. Elapsed time: 0:01:45. Running peak memory: 0.002GB.
PID: 380697; Command: pigz; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2.fastq (380803)


Command completed. Elapsed time: 0:00:59. Running peak memory: 0.002GB.
PID: 380803; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 51533198 PEPPRO RES

Fastq_reads 51533198 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R1.fastq.gz', '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/HEK_PRO-seq_R2.fastq.gz']

FASTQ processing: (06-15 07:20:20) elapsed: 187.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq

(cutadapt -j 12 -m 10 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_R1_cutadapt.txt (381203)


Command completed. Elapsed time: 0:00:40. Running peak memory: 1.773GB.
PID: 381203; Command: cutadapt; Return code: 0; Memory used: 1.773GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq (381274,381275)


Command completed. Elapsed time: 0:00:28. Running peak memory: 1.773GB.
PID: 381274; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381275; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 20103582 PEPPRO RES

Trim_loss_rate 60.99 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq (381328)

Started analysis of HEK_PRO-seq_R1_processed.fastq
Approx 5% complete for HEK_PRO-seq_R1_processed.fastq
Approx 10% complete for HEK_PRO-seq_R1_processed.fastq
Approx 15% complete for HEK_PRO-seq_R1_processed.fastq
Approx 20% complete for HEK_PRO-seq_R1_processed.fastq
Approx 25% complete for HEK_PRO-seq_R1_processed.fastq
Approx 30% complete for HEK_PRO-seq_R1_processed.fastq
Approx 35% complete for HEK_PRO-seq_R1_processed.fastq
Approx 40% complete for HEK_PRO-seq_R1_processed.fastq
Approx 45% complete for HEK_PRO-seq_R1_processed.fastq
Approx 50% complete for HEK_PRO-seq_R1_processed.fastq
Approx 55% complete for HEK_PRO-seq_R1_processed.fastq
Approx 60% complete for HEK_PRO-seq_R1_processed.fastq
Approx 65% complete for HEK_PRO-seq_R1_processed.fastq
Approx 70% complete for HEK_PRO-seq_R1_processed.fastq
Approx 75% complete for HEK_PRO-seq_R1_processed.fastq
Approx 80% complete for HEK_PRO-seq_R1_processed.fastq
Approx 85% complete for HEK_PRO-seq_R1_processed.fastq
Approx 90% complete for HEK_PRO-seq_R1_processed.fastq
Approx 95% complete for HEK_PRO-seq_R1_processed.fastq
Analysis complete for HEK_PRO-seq_R1_processed.fastq
Command completed. Elapsed time: 0:00:42. Running peak memory: 1.773GB.
PID: 381328; Command: fastqc; Return code: 0; Memory used: 0.156GB

FastQC report r1 fastqc/HEK_PRO-seq_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq (381432)

[INFO] 916082 duplicated records removed
Command completed. Elapsed time: 0:00:47. Running peak memory: 1.986GB.
PID: 381432; Command: seqkit; Return code: 0; Memory used: 1.986GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_dedup.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq (381515,381516)


Command completed. Elapsed time: 0:00:21. Running peak memory: 1.986GB.
PID: 381515; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381516; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 16626152.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 5380555.0 PEPPRO RES

Duplicate_reads 916082.0 PEPPRO RES

Pct_uninformative_adapter_reads 20.8819 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/processed_R1.flag (381619)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.986GB.
PID: 381619; Command: touch; Return code: 0; Memory used: 0.0GB

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq

(cutadapt -j 12 -m 10 -O 1 -a GATCGTCGGACTGTAGAACTCTGAAC /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_R2_cutadapt.txt (381621)


Command completed. Elapsed time: 0:01:12. Running peak memory: 1.986GB.
PID: 381621; Command: cutadapt; Return code: 0; Memory used: 1.927GB

seqtk trimfq -b 8 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq | seqtk seq -L 10 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq (381919,381920)


Command completed. Elapsed time: 0:00:27. Running peak memory: 1.986GB.
PID: 381919; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381920; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 40207164 PEPPRO RES

Trim_loss_rate 21.98 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq (381983)

Started analysis of HEK_PRO-seq_R1_processed.fastq
Approx 5% complete for HEK_PRO-seq_R1_processed.fastq
Approx 10% complete for HEK_PRO-seq_R1_processed.fastq
Approx 15% complete for HEK_PRO-seq_R1_processed.fastq
Approx 20% complete for HEK_PRO-seq_R1_processed.fastq
Approx 25% complete for HEK_PRO-seq_R1_processed.fastq
Approx 30% complete for HEK_PRO-seq_R1_processed.fastq
Approx 35% complete for HEK_PRO-seq_R1_processed.fastq
Approx 40% complete for HEK_PRO-seq_R1_processed.fastq
Approx 45% complete for HEK_PRO-seq_R1_processed.fastq
Approx 50% complete for HEK_PRO-seq_R1_processed.fastq
Approx 55% complete for HEK_PRO-seq_R1_processed.fastq
Approx 60% complete for HEK_PRO-seq_R1_processed.fastq
Approx 65% complete for HEK_PRO-seq_R1_processed.fastq
Approx 70% complete for HEK_PRO-seq_R1_processed.fastq
Approx 75% complete for HEK_PRO-seq_R1_processed.fastq
Approx 80% complete for HEK_PRO-seq_R1_processed.fastq
Approx 85% complete for HEK_PRO-seq_R1_processed.fastq
Approx 90% complete for HEK_PRO-seq_R1_processed.fastq
Approx 95% complete for HEK_PRO-seq_R1_processed.fastq
Analysis complete for HEK_PRO-seq_R1_processed.fastq
Command completed. Elapsed time: 0:00:41. Running peak memory: 1.986GB.
PID: 381983; Command: fastqc; Return code: 0; Memory used: 0.155GB

FastQC report r1 fastqc/HEK_PRO-seq_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq (382054)

Started analysis of HEK_PRO-seq_R2_trimmed.fastq
Approx 5% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 10% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 15% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 20% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 25% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 30% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 35% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 40% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 45% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 50% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 55% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 60% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 65% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 70% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 75% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 80% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 85% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 90% complete for HEK_PRO-seq_R2_trimmed.fastq
Approx 95% complete for HEK_PRO-seq_R2_trimmed.fastq
Analysis complete for HEK_PRO-seq_R2_trimmed.fastq
Command completed. Elapsed time: 0:00:34. Running peak memory: 1.986GB.
PID: 382054; Command: fastqc; Return code: 0; Memory used: 0.153GB

FastQC report r2 fastqc/HEK_PRO-seq_R2_trimmed_fastqc.html FastQC report r2 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.histogram

fastq_pair -t 46379878 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq (382246)

Left paired: 20354925       Right paired: 20354925
Left single: 31120      Right single: 456238
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq.single.fq
Command completed. Elapsed time: 0:01:42. Running peak memory: 2.441GB.
PID: 382246; Command: fastq_pair; Return code: 0; Memory used: 2.441GB

flash -q -t 12 --compress-prog=pigz --suffix=gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_noadap.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_noadap.fastq.paired.fq -o HEK_PRO-seq -d /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt (382390)


Command completed. Elapsed time: 0:00:53. Running peak memory: 2.441GB.
PID: 382390; Command: flash; Return code: 0; Memory used: 0.133GB

Plot adapter insertion distribution (06-15 07:29:38) elapsed: 558.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R adapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt -u 8 (382583)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 2.441GB.
PID: 382583; Command: Rscript; Return code: 0; Memory used: 0.287GB

Adapter insertion distribution cutadapt/HEK_PRO-seq_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/HEK_PRO-seq_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print len-8}'

Peak_adapter_insertion_size 37 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:29:44) elapsed: 6.0 TIME

awk '{ if (($1-8) == 10) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist

awk '{ if (($1-8) == 20) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist

awk '{ if (($1-8) == 30) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist

awk '{ if (($1-8) == 40) {status = 1}} END {if (status) {print status} else {print 0}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist

awk '(($1-8 ) <= 20 && ($1-8 ) >= 10){degradedSum += $2}; (($1-8 ) >= 30 && ($1-8) <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/cutadapt/HEK_PRO-seq.hist

Degradation_ratio 0.5783 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq

cp /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq (382613)


Command completed. Elapsed time: 0:00:22. Running peak memory: 2.441GB.
PID: 382613; Command: cp; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/processed_R2.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/processed_R2.flag (382911)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.441GB.
PID: 382911; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/repaired.flag

fastq_pair -t 46379878 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq (382912)

Left paired: 20071296       Right paired: 20071296
Left single: 32287      Right single: 474552
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq.single.fq
Command completed. Elapsed time: 0:01:46. Running peak memory: 2.441GB.
PID: 382912; Command: fastq_pair; Return code: 0; Memory used: 2.009GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq (383044)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.441GB.
PID: 383044; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq (383045)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.441GB.
PID: 383045; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/repaired.flag (383047)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.441GB.
PID: 383047; Command: touch; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/dups_repaired.flag

fastq_pair -t 46379878 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq (383048)

Left paired: 19171561       Right paired: 19171561
Left single: 25508      Right single: 1374287
Writing the paired reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq.paired.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq.paired.fq.
Writing the single reads to /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq.single.fq and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq.single.fq
Command completed. Elapsed time: 0:01:18. Running peak memory: 2.593GB.
PID: 383048; Command: fastq_pair; Return code: 0; Memory used: 2.593GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq (383175)


Command completed. Elapsed time: 0:00:01. Running peak memory: 2.593GB.
PID: 383175; Command: mv; Return code: 0; Memory used: 0.001GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq.paired.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq (383182)


Command completed. Elapsed time: 0:00:01. Running peak memory: 2.593GB.
PID: 383182; Command: mv; Return code: 0; Memory used: 0.001GB

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/dups_repaired.flag (383183)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.593GB.
PID: 383183; Command: touch; Return code: 0; Memory used: 0.0GB

Prealignments (06-15 07:33:13) elapsed: 209.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:33:13) elapsed: 0.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_bt2 (383184)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.593GB.
PID: 383184; Command: mkfifo; Return code: 0; Memory used: 0.0GB

File not added to cleanup: prealignments/human_rDNA_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq (383186)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id HEK_PRO-seq -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_bt2 2>&1 > /dev/null) not gzipping output File not added to cleanup: prealignments/human_rDNA_bt2 Missing stat 'Aligned_reads_human_rDNA' 20071296 reads; of these: 20071296 (100.00%) were unpaired; of these: 17956185 (89.46%) aligned 0 times 2115111 (10.54%) aligned exactly 1 time 0 (0.00%) aligned >1 times 10.54% overall alignment rate

Aligned_reads_human_rDNA 4230222.0 PEPPRO RES

Alignment_rate_human_rDNA 10.52 PEPPRO RES

Map to human_rDNA (06-15 07:36:01) elapsed: 168.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_dups_bt2

mkfifo /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_dups_bt2 (383576)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.593GB.
PID: 383576; Command: mkfifo; Return code: 0; Memory used: 0.002GB

File not added to cleanup: prealignments/human_rDNA_dups_bt2 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq.gz

perl /scratch/jps3dp/tools/databio//peppro/tools/filter_paired_fq.pl /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_dups_bt2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R2_trimmed_dups.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_dups_R1.fq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_dups_R2.fq (383578)

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id HEK_PRO-seq -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/fastq/HEK_PRO-seq_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/human_rDNA_dups_bt2 2>&1 > /dev/null) not gzipping output 2115112 reads skipped 0 reads lost File not added to cleanup: prealignments/human_rDNA_dups_bt2

Map to genome (06-15 07:38:40) elapsed: 159.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id HEK_PRO-seq -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/tmp6ifjo32x -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam (383744,383745,383746)

1726816 reads skipped
0 reads lost
17956184 reads; of these:
  17956184 (100.00%) were paired; of these:
    5503120 (30.65%) aligned concordantly 0 times
    10297215 (57.35%) aligned concordantly exactly 1 time
    2155849 (12.01%) aligned concordantly >1 times
    ----
    5503120 pairs aligned concordantly 0 times; of these:
      1505429 (27.36%) aligned discordantly 1 time
    ----
    3997691 pairs aligned 0 times concordantly or discordantly; of these:
      7995382 mates make up the pairs; of these:
        2807990 (35.12%) aligned 0 times
        2063628 (25.81%) aligned exactly 1 time
        3123764 (39.07%) aligned >1 times
92.18% overall alignment rate
[bam_sort_core] merging from 9 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:33:26. Running peak memory: 3.772GB.
PID: 383745; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 383744; Command: bowtie2; Return code: 0; Memory used: 3.772GB
PID: 383746; Command: samtools; Return code: 0; Memory used: 0.928GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam (387133)


Command completed. Elapsed time: 0:00:51. Running peak memory: 3.772GB.
PID: 387133; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 33104378 PEPPRO RES

QC_filtered_reads 18769818 PEPPRO RES

Aligned_reads 14334559.5 PEPPRO RES

Alignment_rate 35.65 PEPPRO RES

Total_efficiency 27.82 PEPPRO RES

Read_depth 2.41 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam

bowtie2 -p 12 --very-sensitive -X 2000 --rg-id HEK_PRO-seq -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 --rf -1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_dups_R1.fq -2 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_dups_R2.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/tmp6ifjo32x -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp_dups.bam (388990,388996,388997)

17444745 reads; of these:
  17444745 (100.00%) were paired; of these:
    5326191 (30.53%) aligned concordantly 0 times
    10028868 (57.49%) aligned concordantly exactly 1 time
    2089686 (11.98%) aligned concordantly >1 times
    ----
    5326191 pairs aligned concordantly 0 times; of these:
      1467659 (27.56%) aligned discordantly 1 time
    ----
    3858532 pairs aligned 0 times concordantly or discordantly; of these:
      7717064 mates make up the pairs; of these:
        2726098 (35.33%) aligned 0 times
        1998944 (25.90%) aligned exactly 1 time
        2992022 (38.77%) aligned >1 times
92.19% overall alignment rate
[bam_sort_core] merging from 9 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:30:01. Running peak memory: 3.772GB.
PID: 388990; Command: bowtie2; Return code: 0; Memory used: 3.756GB
PID: 388996; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 388997; Command: samtools; Return code: 0; Memory used: 0.906GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam (393207)


Command completed. Elapsed time: 0:00:55. Running peak memory: 3.772GB.
PID: 393207; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 08:57:19) elapsed: 4719.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R1.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R1.fq (393916)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.772GB.
PID: 393916; Command: pigz; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/prealignments/HEK_PRO-seq_human_rDNA_unmap_R2.fq (393975)


Command completed. Elapsed time: 0:00:23. Running peak memory: 3.772GB.
PID: 393975; Command: pigz; Return code: 0; Memory used: 0.013GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam (394034)


Command completed. Elapsed time: 0:00:24. Running peak memory: 3.772GB.
PID: 394034; Command: samtools; Return code: 0; Memory used: 0.013GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 325556 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam (394095)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.772GB.
PID: 394095; Command: samtools; Return code: 0; Memory used: 0.015GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/chr_sizes.bed (394141,394142,394143,394144)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 394142; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 394144; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 394141; Command: samtools; Return code: 0; Memory used: 0.009GB
PID: 394143; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_noMT.bam (394146)


Command completed. Elapsed time: 0:00:28. Running peak memory: 3.772GB.
PID: 394146; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam (394211)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 394211; Command: mv; Return code: 0; Memory used: 0.001GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam (394213)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.772GB.
PID: 394213; Command: samtools; Return code: 0; Memory used: 0.015GB

Split BAM file (06-15 08:59:34) elapsed: 135.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam (394562,394563)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:44. Running peak memory: 3.772GB.
PID: 394562; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 394563; Command: samtools; Return code: 0; Memory used: 3.641GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE2.bam (395221,395222)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:39. Running peak memory: 3.772GB.
PID: 395221; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 395222; Command: samtools; Return code: 0; Memory used: 3.076GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 38 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp_dups.bam (395571)


Command completed. Elapsed time: 0:00:23. Running peak memory: 3.772GB.
PID: 395571; Command: samtools; Return code: 0; Memory used: 0.014GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam.bai Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE1.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE2.bam

samtools view -b -f 64 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE1.bam (396181,396182)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:53. Running peak memory: 3.772GB.
PID: 396181; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 396182; Command: samtools; Return code: 0; Memory used: 3.58GB

samtools view -b -f 128 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_sort_dups.bam | samtools sort - -@ 12 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE2.bam (396694,396695)

[bam_sort_core] merging from 0 files and 12 in-memory blocks...
Command completed. Elapsed time: 0:01:38. Running peak memory: 3.772GB.
PID: 396694; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 396695; Command: samtools; Return code: 0; Memory used: 3.022GB

Calculate library complexity (06-15 09:07:34) elapsed: 479.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE1.bam (397460)

BAM_INPUT
TOTAL READS     = 14923343
COUNTS_SUM      = 14923343
DISTINCT READS  = 1.32013e+07
DISTINCT COUNTS = 220
MAX COUNT       = 14762
COUNTS OF 1     = 1.216e+07
OBSERVED COUNTS (14763)
1   12160007
2   801020
3   141654
4   44209
5   19541
6   10184
7   6080
8   3969
9   2710
10  1970
11  1530
12  1137
13  864
14  760
15  571
16  491
17  498
18  370
19  342
20  262
21  230
22  212
23  195
24  181
25  170
26  146
27  128
28  114
29  96
30  109
31  85
32  81
33  65
34  71
35  68
36  72
37  52
38  39
39  48
40  40
41  41
42  27
43  34
44  29
45  27
46  38
47  28
48  36
49  36
50  21
51  18
52  24
53  12
54  23
55  15
56  18
57  21
58  15
59  18
60  8
61  14
62  16
63  11
64  8
65  8
66  10
67  10
68  11
69  12
70  12
71  5
72  6
73  10
74  5
75  8
76  10
77  5
78  8
79  8
80  5
81  7
82  4
83  5
84  6
85  6
86  3
87  5
88  5
89  4
90  2
91  4
92  6
93  4
94  6
95  5
96  9
97  3
98  6
99  2
100 2
101 4
103 3
104 2
105 4
106 1
107 2
108 3
109 2
110 5
111 4
112 7
113 2
114 3
115 2
116 1
117 1
118 1
120 2
121 2
122 4
123 1
124 1
125 1
126 5
127 2
128 1
129 1
130 3
132 4
133 4
134 2
135 1
137 2
138 1
139 3
140 2
141 2
142 2
145 1
147 2
148 5
149 1
152 2
153 1
158 1
159 1
160 1
161 2
163 1
164 1
165 1
166 1
168 2
169 1
170 1
172 2
176 1
177 1
179 1
182 1
184 2
185 2
188 1
189 1
191 3
194 1
202 1
206 2
208 1
209 2
211 1
215 2
217 1
222 1
224 1
225 3
226 2
229 1
240 2
241 1
244 1
248 1
275 1
276 1
277 1
283 1
287 1
288 1
289 1
292 1
328 1
351 1
358 1
361 1
363 1
404 1
431 2
436 1
469 1
544 1
581 1
610 1
612 1
696 1
726 1
758 1
778 1
880 1
973 1
1110    1
1493    1
1596    1
1700    1
1764    1
1771    1
2430    1
3752    1
5609    1
8568    1
14762   1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 Command completed. Elapsed time: 0:01:19. Running peak memory: 3.772GB.
PID: 397460; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE1.bam (397570)

BAM_INPUT
TOTAL READS     = 14923343
DISTINCT READS  = 1.32013e+07
DISTINCT COUNTS = 220
MAX COUNT       = 14762
COUNTS OF 1     = 1.216e+07
MAX TERMS       = 100
OBSERVED COUNTS (14763)
1   12160007
2   801020
3   141654
4   44209
5   19541
6   10184
7   6080
8   3969
9   2710
10  1970
11  1530
12  1137
13  864
14  760
15  571
16  491
17  498
18  370
19  342
20  262
21  230
22  212
23  195
24  181
25  170
26  146
27  128
28  114
29  96
30  109
31  85
32  81
33  65
34  71
35  68
36  72
37  52
38  39
39  48
40  40
41  41
42  27
43  34
44  29
45  27
46  38
47  28
48  36
49  36
50  21
51  18
52  24
53  12
54  23
55  15
56  18
57  21
58  15
59  18
60  8
61  14
62  16
63  11
64  8
65  8
66  10
67  10
68  11
69  12
70  12
71  5
72  6
73  10
74  5
75  8
76  10
77  5
78  8
79  8
80  5
81  7
82  4
83  5
84  6
85  6
86  3
87  5
88  5
89  4
90  2
91  4
92  6
93  4
94  6
95  5
96  9
97  3
98  6
99  2
100 2
101 4
103 3
104 2
105 4
106 1
107 2
108 3
109 2
110 5
111 4
112 7
113 2
114 3
115 2
116 1
117 1
118 1
120 2
121 2
122 4
123 1
124 1
125 1
126 5
127 2
128 1
129 1
130 3
132 4
133 4
134 2
135 1
137 2
138 1
139 3
140 2
141 2
142 2
145 1
147 2
148 5
149 1
152 2
153 1
158 1
159 1
160 1
161 2
163 1
164 1
165 1
166 1
168 2
169 1
170 1
172 2
176 1
177 1
179 1
182 1
184 2
185 2
188 1
189 1
191 3
194 1
202 1
206 2
208 1
209 2
211 1
215 2
217 1
222 1
224 1
225 3
226 2
229 1
240 2
241 1
244 1
248 1
275 1
276 1
277 1
283 1
287 1
288 1
289 1
292 1
328 1
351 1
358 1
361 1
363 1
404 1
431 2
436 1
469 1
544 1
581 1
610 1
612 1
696 1
726 1
758 1
778 1
880 1
973 1
1110    1
1493    1
1596    1
1700    1
1764    1
1771    1
2430    1
3752    1
5609    1
8568    1
14762   1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] .................................................................................................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:24. Running peak memory: 3.772GB.
PID: 397570; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_dups_PE1.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_counts.txt (397921)


Command completed. Elapsed time: 0:00:19. Running peak memory: 3.772GB.
PID: 397921; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_plot (397941)

Processing HEK_PRO-seq
INFO: Found real counts for HEK_PRO-seq - Total (M): 15.183469 Unique (M): 14.923343

Library complexity plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 397941; Command: Rscript; Return code: 0; Memory used: 0.268GB

Library complexity QC_hg38/HEK_PRO-seq_preseq_plot.pdf Library complexity QC_hg38/HEK_PRO-seq_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.9099 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 09:10:42) elapsed: 188.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam (397960)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.772GB.
PID: 397960; Command: samtools; Return code: 0; Memory used: 0.008GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_bamQC.tsv (397979)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/tmp_HEK_PRO-seq_PE1_q52j1sna'
Processing with 12 cores...
Discarding 105 chunk(s) of reads: ['chrM', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270726v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270748v1', 'chrUn_KI270752v1', 'chrUn_KI270756v1']
Keeping 90 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270725v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270589v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:14. Running peak memory: 3.772GB.
PID: 397979; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.071GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_bamQC.tsv

NRF 1.0 PEPPRO RES

PBC1 7591734.5 PEPPRO RES

PBC2 7591734.5 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_unmap.bam

samtools view -b -@ 12 -f 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_unmap.bam (398020)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398020; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_temp.bam

Unmapped_reads 2807990 PEPPRO RES

Split BAM by strand (06-15 09:11:17) elapsed: 35.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam (398059)


Command completed. Elapsed time: 0:00:45. Running peak memory: 3.772GB.
PID: 398059; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam (398099)


Command completed. Elapsed time: 0:00:44. Running peak memory: 3.772GB.
PID: 398099; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 09:12:46) elapsed: 89.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (398152)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398152; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_plus_TssEnrichment.txt (398154)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398154; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.987GB

TSS_coding_score 16.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_minus_TssEnrichment.txt (398185)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398185; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.981GB

TSS_non-coding_score 2.4 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_minus_TssEnrichment.txt (398216)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 3.772GB.
PID: 398216; Command: Rscript; Return code: 0; Memory used: 0.32GB

TSS enrichment QC_hg38/HEK_PRO-seq_TSSenrichment.pdf TSS enrichment QC_hg38/HEK_PRO-seq_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt (398238,398239,398240,398241)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398238; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 398240; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 398239; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 398241; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt (398243)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398243; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 09:13:03) elapsed: 17.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_tss.bed (398245,398246)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.772GB.
PID: 398245; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 398246; Command: bedtools; Return code: 0; Memory used: 0.099GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed (398250,398251)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398250; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 398251; Command: bedtools; Return code: 0; Memory used: 0.022GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_TSS_density.bed (398254,398255,398256,398257)


Command completed. Elapsed time: 0:00:19. Running peak memory: 3.772GB.
PID: 398254; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 398256; Command: sort; Return code: 0; Memory used: 0.012GB
PID: 398255; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 398257; Command: sort; Return code: 0; Memory used: 0.003GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_gene_body_density.bed (398274,398275,398276)


Command completed. Elapsed time: 0:00:21. Running peak memory: 3.772GB.
PID: 398274; Command: bedtools; Return code: 0; Memory used: 0.035GB
PID: 398276; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 398275; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/tmp3fy58s0e (398295,398296,398297)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398295; Command: join; Return code: 0; Memory used: 0.001GB
PID: 398297; Command: env; Return code: 0; Memory used: 0.006GB
PID: 398296; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/tmp3fy58s0e | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0136883) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/tmp3fy58s0e > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed (398304)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398304; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 10.23 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed (398309)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398309; Command: Rscript; Return code: 0; Memory used: 0.316GB

Pause index QC_hg38/HEK_PRO-seq_pause_index.pdf Pause index QC_hg38/HEK_PRO-seq_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_pause_index.bed (398330)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398330; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 09:13:50) elapsed: 47.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam 14334559.5 5618447

Plus_FRiP 0.39 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam 14334559.5 5337871

Minus_FRiP 0.37 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_gene_sort.bed (398370,398371)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398370; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 398371; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_gene_coverage.bed (398373)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.772GB.
PID: 398373; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed.gz (398391)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398391; Command: ln; Return code: 0; Memory used: 0.0GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed (398392)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398392; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 09:14:38) elapsed: 49.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/raw/hg38_annotations.bed (398401)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398401; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer_sort.bed (398403,398404,398405,398406)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398403; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398404; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 398406; Command: bedtools; Return code: 0; Memory used: 0.047GB
PID: 398405; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_plus_coverage.bed (398409)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398409; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_minus_coverage.bed (398417)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.772GB.
PID: 398417; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_sort.bed (398428,398429,398430,398431)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398428; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398429; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 398431; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 398430; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_plus_coverage.bed (398433)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398433; Command: bedtools; Return code: 0; Memory used: 0.016GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_minus_coverage.bed (398634)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.772GB.
PID: 398634; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region" (398646)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398646; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed (398647,398648,398649,398650)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398647; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398649; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 398648; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 398650; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed (398653)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398653; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_minus_coverage.bed (398662)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398662; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR" (398671)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398671; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR_sort.bed (398672,398673,398674,398675)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398672; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398673; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 398675; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 398674; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_plus_coverage.bed (398678)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398678; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_minus_coverage.bed (398687)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.772GB.
PID: 398687; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR" (398696)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398696; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR_sort.bed (398697,398698,398699,398700)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398697; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398698; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 398700; Command: bedtools; Return code: 0; Memory used: 0.035GB
PID: 398699; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_plus_coverage.bed (398702)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398702; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_minus_coverage.bed (398711)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.772GB.
PID: 398711; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon_sort.bed (398721,398722,398723,398724)


Command completed. Elapsed time: 0:00:03. Running peak memory: 3.772GB.
PID: 398721; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398722; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 398724; Command: bedtools; Return code: 0; Memory used: 0.17GB
PID: 398723; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_plus_coverage.bed (398728)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.772GB.
PID: 398728; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_minus_coverage.bed (398738)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.772GB.
PID: 398738; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron_sort.bed (398748,398749,398750,398751)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398748; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 398750; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 398749; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 398751; Command: bedtools; Return code: 0; Memory used: 0.082GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_plus_coverage.bed (398754)


Command completed. Elapsed time: 0:00:11. Running peak memory: 3.772GB.
PID: 398754; Command: bedtools; Return code: 0; Memory used: 0.019GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_minus_coverage.bed (398766)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.772GB.
PID: 398766; Command: bedtools; Return code: 0; Memory used: 0.022GB

Plot cFRiF/FRiF (06-15 09:16:55) elapsed: 137.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s HEK_PRO-seq -z 3099922541 -n 7704166 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_plus_coverage.bed (398791)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:34. Running peak memory: 3.772GB.
PID: 398791; Command: Rscript; Return code: 0; Memory used: 0.502GB

cFRiF QC_hg38/HEK_PRO-seq_cFRiF.pdf cFRiF QC_hg38/HEK_PRO-seq_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s HEK_PRO-seq -z 3099922541 -n 7704166 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_Intron_plus_coverage.bed (398831)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:26. Running peak memory: 3.772GB.
PID: 398831; Command: Rscript; Return code: 0; Memory used: 0.472GB

FRiF QC_hg38/HEK_PRO-seq_FRiF.pdf FRiF QC_hg38/HEK_PRO-seq_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 09:17:57) elapsed: 62.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_exons_sort.bed (398864,398865)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398864; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 398865; Command: bedtools; Return code: 0; Memory used: 0.099GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_introns_sort.bed (398871,398872,398873)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398871; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 398873; Command: bedtools; Return code: 0; Memory used: 0.006GB
PID: 398872; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_coverage.bed (398880)


Command completed. Elapsed time: 0:00:17. Running peak memory: 3.772GB.
PID: 398880; Command: bedtools; Return code: 0; Memory used: 0.012GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_PE1.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_coverage.bed (398896)


Command completed. Elapsed time: 0:00:19. Running peak memory: 3.772GB.
PID: 398896; Command: bedtools; Return code: 0; Memory used: 0.026GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/14.3345595)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_rpkm.bed (398914,398915,398916)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398914; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 398916; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 398915; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/14.3345595)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_rpkm.bed (398919,398920,398921)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.772GB.
PID: 398919; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 398921; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 398920; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed (398923,398924,398925)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398923; Command: join; Return code: 0; Memory used: 0.001GB
PID: 398925; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 398924; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.25 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed --annotate (398931)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398931; Command: Rscript; Return code: 0; Memory used: 0.316GB

mRNA contamination QC_hg38/HEK_PRO-seq_mRNA_contamination.pdf mRNA contamination QC_hg38/HEK_PRO-seq_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/QC_hg38/HEK_PRO-seq_exon_intron_ratios.bed (398952)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.772GB.
PID: 398952; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 09:18:49) elapsed: 52.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam (398961)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 398961; Command: samtools; Return code: 0; Memory used: 0.012GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 14334559.5 (398966)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_plus.bam'
Temporary files will be stored in: 'tmp_HEK_PRO-seq_plus_cuttrace_9fiv4kcf'
Processing with 4 cores...
Discarding 121 chunk(s) of reads: ['chrM', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1']
Keeping 74 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270519v1', 'chrUn_KI270589v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 74 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_exact_body_0-mer.bw'
Merging 74 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:06:15. Running peak memory: 3.772GB.
PID: 398966; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 3.405GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam (400419)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.772GB.
PID: 400419; Command: samtools; Return code: 0; Memory used: 0.012GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 14334559.5 (400428)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/aligned_hg38/HEK_PRO-seq_minus.bam'
Temporary files will be stored in: 'tmp_HEK_PRO-seq_minus_cuttrace_5prlm0ru'
Processing with 4 cores...
Discarding 117 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr5_GL000208v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270726v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 78 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270725v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270589v1', 'chrUn_KI270330v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 78 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_exact_body_0-mer.bw'
Merging 78 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/HEK_PRO-seq/signal_hg38/HEK_PRO-seq_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:06:16. Running peak memory: 3.772GB.
PID: 400428; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 3.405GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 2:14:20
  • Total elapsed time (all runs): 3:55:34
  • Peak memory (this run): 3.7719 GB
  • Pipeline completed time: 2020-06-15 09:31:31