Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_1 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty
  • Compute host: udc-aj40-13c1
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/
  • Pipeline started at: (06-11 17:35:31) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR7616133.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: False
  • sample_name: Jurkat_ChRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 6
  • verbosity: None

Local input file: /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz

File_mb 1330.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz

ln -sf /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz (26733)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.0GB.
PID: 26733; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1.fastq (26734)


Command completed. Elapsed time: 0:00:53. Running peak memory: 0.002GB.
PID: 26734; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 37740511 PEPPRO RES

Fastq_reads 37740511 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz']

FASTQ processing: (06-11 17:36:47) elapsed: 74.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_processed.fastq

(cutadapt -j 12 -m 8 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt (26828)


Command completed. Elapsed time: 0:00:45. Running peak memory: 2.039GB.
PID: 26828; Command: cutadapt; Return code: 0; Memory used: 2.039GB

seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_noadap.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_processed.fastq (26904,26905)


Command completed. Elapsed time: 0:00:38. Running peak memory: 2.039GB.
PID: 26904; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 26905; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 32783879 PEPPRO RES

Trim_loss_rate 13.13 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_processed.fastq (26963)

Started analysis of Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 5% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 10% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 15% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 20% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 25% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 30% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 35% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 40% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 45% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 50% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 55% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 60% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 65% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 70% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 75% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 80% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 85% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 90% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Approx 95% complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Analysis complete for Jurkat_ChRO-seq_1_R1_processed.fastq
Command completed. Elapsed time: 0:01:06. Running peak memory: 2.039GB.
PID: 26963; Command: fastqc; Return code: 0; Memory used: 0.176GB

FastQC report r1 fastqc/Jurkat_ChRO-seq_1_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_noadap.fastq (27048)

[INFO] 14846147 duplicated records removed
Command completed. Elapsed time: 0:00:41. Running peak memory: 2.039GB.
PID: 27048; Command: seqkit; Return code: 0; Memory used: 1.036GB

seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_dedup.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_trimmed.fastq (27369,27370)


Command completed. Elapsed time: 0:00:21. Running peak memory: 2.039GB.
PID: 27369; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 27370; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 34473620.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 2012355.0 PEPPRO RES

Duplicate_reads 14846147.0 PEPPRO RES

Pct_uninformative_adapter_reads 5.3321 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/processed_R1.flag (27478)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.039GB.
PID: 27478; Command: touch; Return code: 0; Memory used: 0.002GB

Plot adapter insertion distribution (06-11 17:41:41) elapsed: 293.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt -u 6 (27479)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:12. Running peak memory: 2.039GB.
PID: 27479; Command: Rscript; Return code: 0; Memory used: 0.108GB

Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 20 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-11 17:41:52) elapsed: 12.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.9566 PEPPRO RES

Prealignments (06-11 17:41:53) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 17:41:53) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 32783879 reads; of these: 32783879 (100.00%) were unpaired; of these: 29290636 (89.34%) aligned 0 times 3493243 (10.66%) aligned exactly 1 time 0 (0.00%) aligned >1 times 10.66% overall alignment rate

Aligned_reads_human_rDNA 3493243.0 PEPPRO RES

Alignment_rate_human_rDNA 10.66 PEPPRO RES

Map to human_rDNA (06-11 17:44:54) elapsed: 181.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_1 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap_dups.fq 2>&1 > /dev/null)

Map to genome (06-11 17:46:43) elapsed: 109.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/tmpgdqhj09o -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam (28061,28062,28063)

29290636 reads; of these:
  29290636 (100.00%) were unpaired; of these:
    1113286 (3.80%) aligned 0 times
    17309978 (59.10%) aligned exactly 1 time
    10867372 (37.10%) aligned >1 times
96.20% overall alignment rate
[bam_sort_core] merging from 8 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:11:07. Running peak memory: 3.685GB.
PID: 28061; Command: bowtie2; Return code: 0; Memory used: 3.685GB
PID: 28062; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 28063; Command: samtools; Return code: 0; Memory used: 0.9GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam (3548)


Command completed. Elapsed time: 0:00:51. Running peak memory: 3.685GB.
PID: 3548; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 28177350 PEPPRO RES

QC_filtered_reads 6839271 PEPPRO RES

Aligned_reads 21338079 PEPPRO RES

Alignment_rate 65.09 PEPPRO RES

Total_efficiency 56.54 PEPPRO RES

Read_depth 3.87 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam

bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_1 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap_dups.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/tmpgdqhj09o -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp_dups.bam (4698,4703,4704)

18024676 reads; of these:
  18024676 (100.00%) were unpaired; of these:
    856458 (4.75%) aligned 0 times
    10720803 (59.48%) aligned exactly 1 time
    6447415 (35.77%) aligned >1 times
95.25% overall alignment rate
[bam_sort_core] merging from 5 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:07:33. Running peak memory: 3.685GB.
PID: 4698; Command: bowtie2; Return code: 0; Memory used: 3.684GB
PID: 4703; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 4704; Command: samtools; Return code: 0; Memory used: 0.899GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam (5505)


Command completed. Elapsed time: 0:00:35. Running peak memory: 3.685GB.
PID: 5505; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-11 18:14:58) elapsed: 1695.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq (5562)


Command completed. Elapsed time: 0:00:36. Running peak memory: 3.685GB.
PID: 5562; Command: pigz; Return code: 0; Memory used: 0.011GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam (5831)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.685GB.
PID: 5831; Command: samtools; Return code: 0; Memory used: 0.015GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 4738 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam (5859)


Command completed. Elapsed time: 0:00:15. Running peak memory: 3.685GB.
PID: 5859; Command: samtools; Return code: 0; Memory used: 0.015GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/chr_sizes.bed (5883,5884,5885,5886)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 5883; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 5885; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 5884; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 5886; Command: grep; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_noMT.bam (5888)


Command completed. Elapsed time: 0:00:19. Running peak memory: 3.685GB.
PID: 5888; Command: samtools; Return code: 0; Memory used: 0.018GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam (5926)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 5926; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam (5927)


Command completed. Elapsed time: 0:00:15. Running peak memory: 3.685GB.
PID: 5927; Command: samtools; Return code: 0; Memory used: 0.015GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 70 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp_dups.bam (6012)


Command completed. Elapsed time: 0:00:13. Running peak memory: 3.685GB.
PID: 6012; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam.bai

Calculate library complexity (06-11 18:17:51) elapsed: 173.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam (6027)

BAM_INPUT
TOTAL READS     = 13139331
COUNTS_SUM      = 13139331
DISTINCT READS  = 9.95264e+06
DISTINCT COUNTS = 149
MAX COUNT       = 430
COUNTS OF 1     = 8.33143e+06
OBSERVED COUNTS (431)
1   8331431
2   1064073
3   273280
4   110730
5   57100
6   33562
7   21886
8   14351
9   10164
10  7277
11  5449
12  4060
13  3259
14  2572
15  2117
16  1690
17  1348
18  1122
19  924
20  809
21  697
22  515
23  473
24  408
25  362
26  314
27  268
28  197
29  186
30  150
31  147
32  163
33  117
34  133
35  90
36  92
37  78
38  88
39  59
40  50
41  60
42  49
43  34
44  46
45  41
46  32
47  44
48  36
49  27
50  22
51  33
52  22
53  21
54  16
55  20
56  17
57  20
58  12
59  14
60  10
61  9
62  8
63  12
64  9
65  11
66  6
67  8
68  5
69  10
70  8
71  8
72  7
73  3
74  8
75  3
76  6
77  5
78  2
79  3
80  6
81  5
82  6
83  7
84  3
85  4
86  2
87  2
88  3
89  3
90  4
91  2
92  6
93  2
94  4
95  3
96  2
98  1
99  2
100 2
101 1
102 3
104 1
105 1
107 2
108 2
109 1
110 5
111 2
112 1
113 1
114 1
116 2
117 2
118 2
123 1
125 1
126 1
128 1
132 1
133 2
134 1
135 1
136 1
139 1
141 1
143 1
144 1
147 2
150 1
151 1
156 2
167 2
168 1
172 2
174 1
177 1
189 1
191 1
193 2
215 1
216 1
225 1
280 1
296 1
349 1
361 1
388 1
402 1
430 1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 Command completed. Elapsed time: 0:01:12. Running peak memory: 3.685GB.
PID: 6027; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam (6135)

BAM_INPUT
TOTAL READS     = 13139331
DISTINCT READS  = 9.95264e+06
DISTINCT COUNTS = 149
MAX COUNT       = 430
COUNTS OF 1     = 8.33143e+06
MAX TERMS       = 96
OBSERVED COUNTS (431)
1   8331431
2   1064073
3   273280
4   110730
5   57100
6   33562
7   21886
8   14351
9   10164
10  7277
11  5449
12  4060
13  3259
14  2572
15  2117
16  1690
17  1348
18  1122
19  924
20  809
21  697
22  515
23  473
24  408
25  362
26  314
27  268
28  197
29  186
30  150
31  147
32  163
33  117
34  133
35  90
36  92
37  78
38  88
39  59
40  50
41  60
42  49
43  34
44  46
45  41
46  32
47  44
48  36
49  27
50  22
51  33
52  22
53  21
54  16
55  20
56  17
57  20
58  12
59  14
60  10
61  9
62  8
63  12
64  9
65  11
66  6
67  8
68  5
69  10
70  8
71  8
72  7
73  3
74  8
75  3
76  6
77  5
78  2
79  3
80  6
81  5
82  6
83  7
84  3
85  4
86  2
87  2
88  3
89  3
90  4
91  2
92  6
93  2
94  4
95  3
96  2
98  1
99  2
100 2
101 1
102 3
104 1
105 1
107 2
108 2
109 1
110 5
111 2
112 1
113 1
114 1
116 2
117 2
118 2
123 1
125 1
126 1
128 1
132 1
133 2
134 1
135 1
136 1
139 1
141 1
143 1
144 1
147 2
150 1
151 1
156 2
167 2
168 1
172 2
174 1
177 1
189 1
191 1
193 2
215 1
216 1
225 1
280 1
296 1
349 1
361 1
388 1
402 1
430 1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] .................................................................................................... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:01:13. Running peak memory: 3.685GB.
PID: 6135; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort_dups.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_counts.txt (6527)


Command completed. Elapsed time: 0:00:22. Running peak memory: 3.685GB.
PID: 6527; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_plot (6549)

Processing Jurkat_ChRO-seq_1
INFO: Found real counts for Jurkat_ChRO-seq_1 - Total (M): 21.334642 Unique (M): 13.139331

Library complexity plot completed!

Command completed. Elapsed time: 0:00:12. Running peak memory: 3.685GB.
PID: 6549; Command: Rscript; Return code: 0; Memory used: 0.085GB

Library complexity QC_hg38/Jurkat_ChRO-seq_1_preseq_plot.pdf Library complexity QC_hg38/Jurkat_ChRO-seq_1_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.7897 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-11 18:20:51) elapsed: 180.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv (6575)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmp_Jurkat_ChRO-seq_1_sort_qn69eg_r'
Processing with 12 cores...
Discarding 109 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr22_KI270732v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1']
Keeping 86 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270579v1', 'chrUn_KI270330v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270752v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:23. Running peak memory: 3.685GB.
PID: 6575; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.521GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv

NRF 0.38 PEPPRO RES

PBC1 0.64 PEPPRO RES

PBC2 3.39 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_unmap.bam (6641)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.685GB.
PID: 6641; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_temp.bam

Unmapped_reads 1113286 PEPPRO RES

Split BAM by strand (06-11 18:21:24) elapsed: 33.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam (6680)


Command completed. Elapsed time: 0:01:00. Running peak memory: 3.685GB.
PID: 6680; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam (6747)


Command completed. Elapsed time: 0:00:59. Running peak memory: 3.685GB.
PID: 6747; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-11 18:23:23) elapsed: 119.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (6824)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 6824; Command: sed; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_plus_TssEnrichment.txt (6825)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.685GB.
PID: 6825; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.534GB

TSS_coding_score 55.1 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_minus_TssEnrichment.txt (6860)


Command completed. Elapsed time: 0:00:06. Running peak memory: 3.685GB.
PID: 6860; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.726GB

TSS_non-coding_score 12.6 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_minus_TssEnrichment.txt (6893)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:11. Running peak memory: 3.685GB.
PID: 6893; Command: Rscript; Return code: 0; Memory used: 0.108GB

TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt (6919,6920,6921,6922)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 6919; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 6921; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 6920; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 6922; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt (6924)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 6924; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-11 18:23:49) elapsed: 26.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_tss.bed (6926,6927)


Command completed. Elapsed time: 0:00:03. Running peak memory: 3.685GB.
PID: 6926; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 6927; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed (6931,6932)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.685GB.
PID: 6931; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 6932; Command: bedtools; Return code: 0; Memory used: 0.004GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed (6934,6935,6936,6937)


Command completed. Elapsed time: 0:00:26. Running peak memory: 3.685GB.
PID: 6935; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 6937; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 6934; Command: bedtools; Return code: 0; Memory used: 0.027GB
PID: 6936; Command: sort; Return code: 0; Memory used: 0.004GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed (6977,6978,6979)


Command completed. Elapsed time: 0:00:33. Running peak memory: 3.685GB.
PID: 6979; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 6977; Command: bedtools; Return code: 0; Memory used: 0.099GB
PID: 6978; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed
awk: cmd. line:1: { if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}} awk: cmd. line:1: ^ syntax error awk: cmd. line:1: { if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}} awk: cmd. line:1: ^ syntax error

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmpf89gr92g (7009,7010,7011)


Got SIGTERM. Failing gracefully... (06-11 18:55:14) elapsed: 1885.0 TIME
Child process 7009 (join) terminated after 0 sec.
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/recover.lock.QC_hg38__Jurkat_ChRO-seq_1_pause_index.bed

Pipeline failed at: (06-11 18:55:14) elapsed: 0.0 TIME

Total time: 1:19:45 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_1 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba26-12
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/
  • Pipeline started at: (06-11 19:11:35) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR7616133.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: Jurkat_ChRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 6
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/PEPPRO_failed.flag' Local input file: /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz

File_mb 1330.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz']

FASTQ processing: (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/processed_R1.flag

Plot adapter insertion distribution (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-11 19:11:36) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 19:11:36) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq

Map to human_rDNA (06-11 19:11:36) elapsed: 0.0 TIME

Map to genome (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam

Compress all unmapped read files (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_unmap.bam

Split BAM by strand (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam

Calculate TSS enrichment (06-11 19:11:36) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf

TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-11 19:11:36) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed
Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/lock.QC_hg38__Jurkat_ChRO-seq_1_pause_index.bed Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmpztt2wubq (45321,45322,45323)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.006GB.
PID: 45321; Command: join; Return code: 0; Memory used: 0.001GB
PID: 45323; Command: env; Return code: 0; Memory used: 0.006GB
PID: 45322; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmpztt2wubq | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]} /bin/sh: -c: line 0: unexpected EOF while looking for matching `'' /bin/sh: -c: line 1: syntax error: unexpected end of file

Pipeline failed at: (06-11 19:11:36) elapsed: 0.0 TIME

Total time: 0:00:01 Failure reason: Command 'awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmpztt2wubq | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' returned non-zero exit status 1.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_1 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba27-28c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/
  • Pipeline started at: (06-14 21:14:42) elapsed: 6.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR7616133.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: Jurkat_ChRO-seq_1
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 6
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/PEPPRO_failed.flag' Local input file: /project/shefflab/data//sra_fastq/SRR7616133.fastq.gz

File_mb 1330.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/Jurkat_ChRO-seq_1_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/Jurkat_ChRO-seq_1.fastq.gz']

FASTQ processing: (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/fastq/processed_R1.flag

Plot adapter insertion distribution (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_1_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-14 21:14:43) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-14 21:14:43) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq

Map to human_rDNA (06-14 21:14:43) elapsed: 0.0 TIME

Map to genome (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam

Compress all unmapped read files (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/prealignments/Jurkat_ChRO-seq_1_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_unmap.bam

Split BAM by strand (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam

Calculate TSS enrichment (06-14 21:14:43) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf

TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_1_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-14 21:14:43) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmp6gr4kvrx (304870,304873,304875)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 304870; Command: join; Return code: 0; Memory used: 0.001GB
PID: 304875; Command: env; Return code: 0; Memory used: 0.004GB
PID: 304873; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmp6gr4kvrx | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0149084) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/tmp6gr4kvrx > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed (304905)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 304905; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 42.69 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed (304910)

Pause index plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.244GB.
PID: 304910; Command: Rscript; Return code: 0; Memory used: 0.244GB

Pause index QC_hg38/Jurkat_ChRO-seq_1_pause_index.pdf Pause index QC_hg38/Jurkat_ChRO-seq_1_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_pause_index.bed (304933)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 304933; Command: pigz; Return code: 0; Memory used: 0.004GB

Calculate Fraction of Reads in pre-mature mRNA (06-14 21:14:49) elapsed: 7.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam 21338079 7688297

Plus_FRiP 0.36 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam 21338079 7358614

Minus_FRiP 0.34 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_gene_sort.bed (305367,305368)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 305367; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 305368; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_gene_coverage.bed (305370)


Command completed. Elapsed time: 0:00:29. Running peak memory: 0.244GB.
PID: 305370; Command: bedtools; Return code: 0; Memory used: 0.085GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed.gz (305399)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 305399; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed (305400)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 305400; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-14 21:15:57) elapsed: 68.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/raw/hg38_annotations.bed (305409)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 305409; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer_sort.bed (305412,305413,305414,305415)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 305412; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 305413; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 305415; Command: bedtools; Return code: 0; Memory used: 0.046GB
PID: 305414; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_plus_coverage.bed (305417)


Command completed. Elapsed time: 0:00:11. Running peak memory: 0.244GB.
PID: 305417; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_minus_coverage.bed (305428)


Command completed. Elapsed time: 0:00:11. Running peak memory: 0.244GB.
PID: 305428; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_sort.bed (305538,305539,305540,305541)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 305538; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 305539; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 305541; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 305540; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_plus_coverage.bed (305554)


Command completed. Elapsed time: 0:00:12. Running peak memory: 0.244GB.
PID: 305554; Command: bedtools; Return code: 0; Memory used: 0.037GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_minus_coverage.bed (305661)


Command completed. Elapsed time: 0:00:12. Running peak memory: 0.244GB.
PID: 305661; Command: bedtools; Return code: 0; Memory used: 0.031GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region" (305675)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 305675; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed (305676,305677,305678,305679)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 305676; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 305678; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 305677; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 305679; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed (305682)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.244GB.
PID: 305682; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_minus_coverage.bed (307252)


Command completed. Elapsed time: 0:00:12. Running peak memory: 0.244GB.
PID: 307252; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR" (316865)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 316865; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR_sort.bed (317008,317009,317010,317011)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 317008; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 317009; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 317011; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 317010; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_plus_coverage.bed (317625)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.244GB.
PID: 317625; Command: bedtools; Return code: 0; Memory used: 0.028GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_minus_coverage.bed (332877)


Command completed. Elapsed time: 0:00:12. Running peak memory: 0.244GB.
PID: 332877; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR" (348684)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.244GB.
PID: 348684; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR_sort.bed (348882,348918,348937,348945)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.244GB.
PID: 348882; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 348918; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 348945; Command: bedtools; Return code: 0; Memory used: 0.013GB
PID: 348937; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_plus_coverage.bed (350591)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.244GB.
PID: 350591; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_minus_coverage.bed (374792)


Command completed. Elapsed time: 0:00:14. Running peak memory: 0.244GB.
PID: 374792; Command: bedtools; Return code: 0; Memory used: 0.014GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon_sort.bed (397491,397549,397556,397558)


Command completed. Elapsed time: 0:00:03. Running peak memory: 0.244GB.
PID: 397491; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 397549; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 397558; Command: bedtools; Return code: 0; Memory used: 0.177GB
PID: 397556; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_plus_coverage.bed (403618)


Command completed. Elapsed time: 0:00:15. Running peak memory: 0.244GB.
PID: 403618; Command: bedtools; Return code: 0; Memory used: 0.057GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_minus_coverage.bed (429156)


Command completed. Elapsed time: 0:00:14. Running peak memory: 0.244GB.
PID: 429156; Command: bedtools; Return code: 0; Memory used: 0.035GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron_sort.bed (447116,447165,447182,447189)


Command completed. Elapsed time: 0:00:02. Running peak memory: 0.244GB.
PID: 447116; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 447182; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 447165; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 447189; Command: bedtools; Return code: 0; Memory used: 0.083GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_plus_coverage.bed (449088)


Command completed. Elapsed time: 0:00:15. Running peak memory: 0.244GB.
PID: 449088; Command: bedtools; Return code: 0; Memory used: 0.045GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_minus_coverage.bed (1087)


Command completed. Elapsed time: 0:00:14. Running peak memory: 0.244GB.
PID: 1087; Command: bedtools; Return code: 0; Memory used: 0.049GB

Plot cFRiF/FRiF (06-14 21:19:07) elapsed: 190.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_1 -z 3099922541 -n 10780321 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_plus_coverage.bed (1141)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:36. Running peak memory: 0.469GB.
PID: 1141; Command: Rscript; Return code: 0; Memory used: 0.469GB

cFRiF QC_hg38/Jurkat_ChRO-seq_1_cFRiF.pdf cFRiF QC_hg38/Jurkat_ChRO-seq_1_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_1 -z 3099922541 -n 10780321 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_Intron_plus_coverage.bed (1220)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:26. Running peak memory: 0.469GB.
PID: 1220; Command: Rscript; Return code: 0; Memory used: 0.467GB

FRiF QC_hg38/Jurkat_ChRO-seq_1_FRiF.pdf FRiF QC_hg38/Jurkat_ChRO-seq_1_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-14 21:20:10) elapsed: 63.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_exons_sort.bed (1653,1654)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.469GB.
PID: 1654; Command: bedtools; Return code: 0; Memory used: 0.099GB
PID: 1653; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_introns_sort.bed (1668,1669,1670)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.469GB.
PID: 1668; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 1670; Command: bedtools; Return code: 0; Memory used: 0.006GB
PID: 1669; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_coverage.bed (1694)


Command completed. Elapsed time: 0:00:22. Running peak memory: 0.469GB.
PID: 1694; Command: bedtools; Return code: 0; Memory used: 0.039GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_coverage.bed (1756)


Command completed. Elapsed time: 0:00:25. Running peak memory: 0.469GB.
PID: 1756; Command: bedtools; Return code: 0; Memory used: 0.068GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/21.338079)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_rpkm.bed (1778,1779,1780)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.469GB.
PID: 1778; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 1780; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 1779; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/21.338079)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_rpkm.bed (1782,1783,1784)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.469GB.
PID: 1782; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 1784; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 1783; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed (1786,1787,1788)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.469GB.
PID: 1786; Command: join; Return code: 0; Memory used: 0.001GB
PID: 1788; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 1787; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.19 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed --annotate (1795)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 0.469GB.
PID: 1795; Command: Rscript; Return code: 0; Memory used: 0.316GB

mRNA contamination QC_hg38/Jurkat_ChRO-seq_1_mRNA_contamination.pdf mRNA contamination QC_hg38/Jurkat_ChRO-seq_1_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/QC_hg38/Jurkat_ChRO-seq_1_exon_intron_ratios.bed (1815)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.469GB.
PID: 1815; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-14 21:21:13) elapsed: 63.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam (1823)


Command completed. Elapsed time: 0:00:07. Running peak memory: 0.469GB.
PID: 1823; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 21338079.0 (1830)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_plus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_1_plus_cuttrace_gbzfszua'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 122 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr9_KI270717v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr14_GL000009v2_random', 'chr15_KI270727v1_random', 'chr22_KI270732v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_KI270743v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270742v1']
Keeping 73 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr11_KI270721v1_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270579v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_GL000213v1', 'chrUn_KI270744v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 73 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_exact_body_0-mer.bw'
Merging 73 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:06:37. Running peak memory: 2.442GB.
PID: 1830; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.442GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam (311235)


Command completed. Elapsed time: 0:00:07. Running peak memory: 2.442GB.
PID: 311235; Command: samtools; Return code: 0; Memory used: 0.009GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 21338079.0 (311251)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/aligned_hg38/Jurkat_ChRO-seq_1_minus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_1_minus_cuttrace_or0c10qu'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 126 chunk(s) of reads: ['chrM', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1']
Keeping 69 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270538v1', 'chrUn_KI270580v1', 'chrUn_KI270330v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 69 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_exact_body_0-mer.bw'
Merging 69 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_1/signal_hg38/Jurkat_ChRO-seq_1_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:06:27. Running peak memory: 3.351GB.
PID: 311251; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 3.351GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 0:19:54
  • Total elapsed time (all runs): 1:16:55
  • Peak memory (this run): 3.3511 GB
  • Pipeline completed time: 2020-06-14 21:34:30