### Pipeline run code and environment:
* Command: `/scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_2 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty -R`
* Compute host: udc-ba25-32c0
* Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
* Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/
* Pipeline started at: (06-15 07:17:12) elapsed: 1.0 _TIME_
### Version log:
* Python version: 3.6.6
* Pypiper dir: `/sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper`
* Pypiper version: 0.12.1
* Pipeline dir: `/sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines`
* Pipeline version: 0.9.8
* Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
* Pipeline branch: * master
* Pipeline date: 2020-06-09 11:36:49 -0400
* Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)
### Arguments passed to pipeline:
* `TSS_name`: `None`
* `adapter`: `cutadapt`
* `anno_name`: `None`
* `complexity`: `False`
* `config_file`: `peppro.yaml`
* `cores`: `12`
* `coverage`: `False`
* `dedup`: `seqkit`
* `dirty`: `True`
* `ensembl_gene_body`: `None`
* `ensembl_tss`: `None`
* `exon_name`: `None`
* `force_follow`: `False`
* `genome_assembly`: `hg38`
* `input`: `['/project/shefflab/data//sra_fastq/SRR7616134.fastq.gz']`
* `input2`: `None`
* `intron_name`: `None`
* `keep`: `False`
* `logdev`: `False`
* `max_len`: `-1`
* `mem`: `12000`
* `new_start`: `False`
* `no_fifo`: `False`
* `output_parent`: `/project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline`
* `paired_end`: `False`
* `pre_name`: `None`
* `prealignments`: `['human_rDNA']`
* `prioritize`: `False`
* `protocol`: `PRO`
* `recover`: `True`
* `sample_name`: `Jurkat_ChRO-seq_2`
* `scale`: `True`
* `search_file`: `None`
* `silent`: `False`
* `single_or_paired`: `SINGLE`
* `sob`: `False`
* `testmode`: `False`
* `trimmer`: `seqtk`
* `umi_len`: `6`
* `verbosity`: `None`
----------------------------------------
Local input file: /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz
> `File_mb` 1914.91 PEPPRO _RES_
> `Read_type` SINGLE PEPPRO _RES_
> `Genome` hg38 PEPPRO _RES_
Detected PRO input
### Merge/link and fastq conversion: (06-15 07:17:13) elapsed: 1.0 _TIME_
Number of input file sets: 1
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz`
> `ln -sf /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz` (380685)
Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380685; Command: ln; Return code: 0; Memory used: 0.0GB
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz'
Found .fastq.gz file
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq`
> `pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq` (380689)
Command completed. Elapsed time: 0:02:57. Running peak memory: 0.002GB.
PID: 380689; Command: pigz; Return code: 0; Memory used: 0.002GB
> `Raw_reads` 49841170 PEPPRO _RES_
> `Fastq_reads` 49841170 PEPPRO _RES_
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz']
### FASTQ processing: (06-15 07:21:39) elapsed: 266.0 _TIME_
> `cutadapt --version`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq`
> `(cutadapt -j 12 -m 8 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt` (381356)
Command completed. Elapsed time: 0:02:08. Running peak memory: 3.496GB.
PID: 381356; Command: cutadapt; Return code: 0; Memory used: 3.496GB
> `seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq` (381610,381611)
Command completed. Elapsed time: 0:01:32. Running peak memory: 3.496GB.
PID: 381610; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381611; Command: seqtk; Return code: 0; Memory used: 0.002GB
Evaluating read trimming
> `Trimmed_reads` 48264585 PEPPRO _RES_
> `Trim_loss_rate` 3.16 PEPPRO _RES_
Targetless command, running...
> `fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq` (382001)
Started analysis of Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 5% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 10% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 15% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 20% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 25% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 30% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 35% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 40% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 45% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 50% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 55% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 60% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 65% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 70% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 75% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 80% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 85% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 90% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 95% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Analysis complete for Jurkat_ChRO-seq_2_R1_processed.fastq
#
# A fatal error has been detected by the Java Runtime Environment:
#
# SIGSEGV (0xb) at pc=0x00007efea9c3ba34, pid=382001, tid=0x00007efe8eff7700
#
# JRE version: Java(TM) SE Runtime Environment (8.0_171-b11) (build 1.8.0_171-b11)
# Java VM: Java HotSpot(TM) 64-Bit Server VM (25.171-b11 mixed mode linux-amd64 compressed oops)
# Problematic frame:
# V [libjvm.so+0xa35a34] NMethodSweeper::sweep_code_cache()+0x524
#
# Core dump written. Default location: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/core or core.382001
#
# An error report file with more information is saved as:
# /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/hs_err_pid382001.log
#
# If you would like to submit a bug report, please visit:
# http://bugreport.java.com/bugreport/crash.jsp
#
Command completed. Elapsed time: 0:01:52. Running peak memory: 3.496GB.
PID: 382001; Command: fastqc; Return code: -6; Memory used: 0.182GB
Subprocess returned nonzero result. Check above output for details
ERROR: Subprocess returned nonzero result, but pipeline is continuing because nofail=True
> `FastQC report r1` fastqc/Jurkat_ChRO-seq_2_R1_processed_fastqc.html FastQC report r1 None PEPPRO _OBJ_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq`
> `seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq` (382314)
[INFO][0m 5764233 duplicated records removed
Command completed. Elapsed time: 0:02:06. Running peak memory: 4.061GB.
PID: 382314; Command: seqkit; Return code: 0; Memory used: 4.061GB
> `seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq` (382617,382618)
Command completed. Elapsed time: 0:01:00. Running peak memory: 4.061GB.
PID: 382617; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 382618; Command: seqtk; Return code: 0; Memory used: 0.002GB
> `grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'`
> `Reads_with_adapter` 42416468.0 PEPPRO _RES_
> `grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'`
> `awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt`
> `wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq | awk '{print $1}'`
> `Uninformative_adapter_reads` 223715.0 PEPPRO _RES_
> `Duplicate_reads` 5764233.0 PEPPRO _RES_
> `Pct_uninformative_adapter_reads` 0.4489 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag`
> `touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag` (383074)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 383074; Command: touch; Return code: 0; Memory used: 0.002GB
### Plot adapter insertion distribution (06-15 07:32:20) elapsed: 641.0 _TIME_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt -u 6` (383075)
Adapter insertion distribution plot completed!
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 383075; Command: Rscript; Return code: 0; Memory used: 0.316GB
> `Adapter insertion distribution` cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.png PEPPRO _OBJ_
Missing stat 'Peak_adapter_insertion_size'
> `awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'`
> `Peak_adapter_insertion_size` 39 PEPPRO _RES_
Missing stat 'Degradation_ratio'
### Calculating degradation ratio (06-15 07:32:24) elapsed: 5.0 _TIME_
> `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'`
> `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'`
> `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'`
> `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'`
> `awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'`
> `Degradation_ratio` 0.4899 PEPPRO _RES_
### Prealignments (06-15 07:32:24) elapsed: 0.0 _TIME_
Prealignment assemblies: ['human_rDNA']
### Map to human_rDNA (06-15 07:32:24) elapsed: 0.0 _TIME_
> `(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq 2>&1 > /dev/null)`
Missing stat 'Aligned_reads_human_rDNA'
48264585 reads; of these:
48264585 (100.00%) were unpaired; of these:
44313938 (91.81%) aligned 0 times
3950647 (8.19%) aligned exactly 1 time
0 (0.00%) aligned >1 times
8.19% overall alignment rate
> `Aligned_reads_human_rDNA` 3950647.0 PEPPRO _RES_
> `Alignment_rate_human_rDNA` 8.19 PEPPRO _RES_
### Map to human_rDNA (06-15 07:37:49) elapsed: 325.0 _TIME_
> `(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq 2>&1 > /dev/null)`
### Map to genome (06-15 07:42:21) elapsed: 272.0 _TIME_
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam`
> `bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam` (384181,384182,384183)
44313938 reads; of these:
44313938 (100.00%) were unpaired; of these:
2435871 (5.50%) aligned 0 times
29426081 (66.40%) aligned exactly 1 time
12451986 (28.10%) aligned >1 times
94.50% overall alignment rate
[bam_sort_core] merging from 12 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:17:27. Running peak memory: 4.061GB.
PID: 384181; Command: bowtie2; Return code: 0; Memory used: 3.689GB
PID: 384182; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 384183; Command: samtools; Return code: 0; Memory used: 0.898GB
> `samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (385717)
Command completed. Elapsed time: 0:01:10. Running peak memory: 4.061GB.
PID: 385717; Command: samtools; Return code: 0; Memory used: 0.018GB
> `samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'`
> `Mapped_reads` 41878067 PEPPRO _RES_
> `QC_filtered_reads` 7874013 PEPPRO _RES_
> `Aligned_reads` 34004054 PEPPRO _RES_
> `Alignment_rate` 70.45 PEPPRO _RES_
> `Total_efficiency` 68.22 PEPPRO _RES_
> `Read_depth` 4.27 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam`
> `bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam` (387215,387216,387217)
39606611 reads; of these:
39606611 (100.00%) were unpaired; of these:
2278810 (5.75%) aligned 0 times
26411590 (66.68%) aligned exactly 1 time
10916211 (27.56%) aligned >1 times
94.25% overall alignment rate
[bam_sort_core] merging from 11 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:14:27. Running peak memory: 4.061GB.
PID: 387215; Command: bowtie2; Return code: 0; Memory used: 3.69GB
PID: 387216; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 387217; Command: samtools; Return code: 0; Memory used: 0.898GB
> `samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (389084)
Command completed. Elapsed time: 0:01:04. Running peak memory: 4.061GB.
PID: 389084; Command: samtools; Return code: 0; Memory used: 0.018GB
### Compress all unmapped read files (06-15 08:28:56) elapsed: 2794.0 _TIME_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq.gz`
> `pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq` (389153)
Command completed. Elapsed time: 0:00:55. Running peak memory: 4.061GB.
PID: 389153; Command: pigz; Return code: 0; Memory used: 0.013GB
Missing stat 'Mitochondrial_reads'
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam.bai`
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam` (389213)
Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB.
PID: 389213; Command: samtools; Return code: 0; Memory used: 0.011GB
> `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3`
> `Mitochondrial_reads` 18250 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam`
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389520)
Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB.
PID: 389520; Command: samtools; Return code: 0; Memory used: 0.012GB
> `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed` (389540,389541,389542,389543)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 389541; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 389543; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 389540; Command: samtools; Return code: 0; Memory used: 0.01GB
PID: 389542; Command: awk; Return code: 0; Memory used: 0.0GB
> `samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam` (389545)
Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB.
PID: 389545; Command: samtools; Return code: 0; Memory used: 0.018GB
> `mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389588)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 389588; Command: mv; Return code: 0; Memory used: 0.001GB
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389589)
Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB.
PID: 389589; Command: samtools; Return code: 0; Memory used: 0.012GB
Missing stat 'Maximum_read_length'
> `samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-`
> `Maximum_read_length` 70 PEPPRO _RES_
Missing stat 'Genome_size'
> `awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes`
> `Genome_size` 3099922541 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam.bai`
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam` (389692)
Command completed. Elapsed time: 0:00:27. Running peak memory: 4.061GB.
PID: 389692; Command: samtools; Return code: 0; Memory used: 0.013GB
> `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3`
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam`
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam.bai
### Calculate library complexity (06-15 08:33:38) elapsed: 282.0 _TIME_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt`
> `preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (389719)
BAM_INPUT
TOTAL READS = 30468400
COUNTS_SUM = 30468400
DISTINCT READS = 1.6294e+07
DISTINCT COUNTS = 1118
MAX COUNT = 6926
COUNTS OF 1 = 1.31032e+07
OBSERVED COUNTS (6927)
1 13103248
2 1726484
3 540128
4 254315
5 147467
6 96195
7 68125
8 50567
9 38638
10 30601
11 24915
12 20508
13 17467
14 14643
15 12769
16 11038
17 9701
18 8575
19 7601
20 6875
21 6210
22 5518
23 5088
24 4592
25 4188
26 3754
27 3445
28 3289
29 3024
30 2717
31 2588
32 2388
33 2274
34 2083
35 1899
36 1954
37 1666
38 1757
39 1529
40 1529
41 1388
42 1291
43 1263
44 1190
45 1148
46 1044
47 1022
48 1000
49 892
50 889
51 866
52 835
53 786
54 762
55 698
56 720
57 663
58 663
59 576
60 563
61 564
62 562
63 446
64 491
65 459
66 481
67 422
68 461
69 374
70 387
71 407
72 394
73 365
74 388
75 349
76 317
77 319
78 327
79 317
80 292
81 306
82 282
83 283
84 271
85 249
86 243
87 263
88 248
89 234
90 226
91 209
92 214
93 208
94 191
95 187
96 197
97 195
98 194
99 182
100 187
101 170
102 173
103 179
104 162
105 134
106 142
107 138
108 143
109 124
110 141
111 156
112 146
113 122
114 126
115 121
116 124
117 113
118 117
119 121
120 107
121 116
122 129
123 104
124 107
125 103
126 94
127 90
128 79
129 94
130 103
131 94
132 97
133 92
134 78
135 84
136 98
137 73
138 78
139 73
140 76
141 82
142 77
143 62
144 71
145 84
146 65
147 79
148 62
149 69
150 73
151 63
152 65
153 64
154 59
155 62
156 65
157 56
158 60
159 46
160 60
161 50
162 47
163 55
164 47
165 41
166 54
167 55
168 49
169 49
170 48
171 50
172 64
173 52
174 36
175 56
176 42
177 45
178 42
179 40
180 37
181 32
182 57
183 46
184 41
185 39
186 43
187 37
188 37
189 35
190 32
191 37
192 48
193 31
194 31
195 36
196 34
197 32
198 32
199 32
200 37
201 35
202 31
203 30
204 22
205 38
206 32
207 34
208 27
209 15
210 22
211 18
212 29
213 32
214 30
215 33
216 32
217 36
218 17
219 20
220 23
221 19
222 36
223 22
224 26
225 28
226 25
227 26
228 28
229 18
230 23
231 29
232 24
233 20
234 28
235 30
236 23
237 14
238 19
239 16
240 10
241 9
242 22
243 29
244 17
245 18
246 11
247 17
248 23
249 15
250 19
251 13
252 16
253 28
254 20
255 14
256 16
257 11
258 14
259 13
260 9
261 16
262 15
263 14
264 16
265 15
266 12
267 17
268 17
269 20
270 11
271 15
272 17
273 12
274 15
275 15
276 29
277 15
278 14
279 22
280 11
281 13
282 19
283 9
284 15
285 17
286 9
287 16
288 16
289 10
290 8
291 15
292 10
293 8
294 10
295 14
296 11
297 12
298 14
299 3
300 14
301 12
302 12
303 14
304 5
305 18
306 10
307 9
308 8
309 16
310 13
311 16
312 10
313 11
314 14
315 11
316 16
317 7
318 9
319 10
320 10
321 7
322 6
323 9
324 10
325 11
326 10
327 12
328 16
329 6
330 8
331 6
332 10
333 7
334 9
335 7
336 10
337 5
338 8
339 5
340 5
341 5
342 6
343 6
344 9
345 3
346 13
347 11
348 2
349 5
350 10
351 7
352 6
353 6
354 6
355 6
356 8
357 9
358 8
359 9
360 2
361 6
362 7
363 6
364 2
365 2
366 5
367 6
368 6
369 7
370 4
371 3
372 3
373 10
374 8
375 7
376 5
377 4
378 5
379 3
380 6
381 3
382 4
383 6
384 4
385 1
386 5
387 3
388 5
389 8
390 3
391 5
392 3
393 5
394 2
395 7
396 3
397 6
398 7
399 3
400 3
401 3
402 5
403 3
404 7
405 6
406 1
407 7
408 7
409 6
410 5
411 7
412 2
413 6
414 9
415 3
416 3
417 4
418 5
419 3
420 6
421 1
422 4
423 5
424 7
425 4
426 5
427 7
428 4
429 7
430 6
431 11
432 7
433 3
434 5
435 7
436 4
437 3
438 6
439 4
440 2
441 5
442 6
443 5
444 3
445 3
446 3
447 5
448 4
449 7
450 2
451 5
452 3
453 6
454 2
455 4
456 5
457 8
458 4
459 5
460 3
461 3
462 1
463 4
464 3
465 4
466 1
467 2
468 6
469 4
470 4
471 3
472 3
473 4
474 2
475 2
476 4
477 1
478 6
479 4
480 1
481 5
482 1
483 4
484 2
486 4
487 2
488 5
489 4
490 6
491 3
492 5
493 8
494 2
495 3
496 1
497 2
498 5
499 1
500 4
501 6
502 4
503 1
504 1
505 4
506 4
507 1
508 4
509 2
510 3
511 2
513 6
514 2
515 2
516 6
517 7
518 2
519 3
520 1
521 6
522 2
523 5
524 1
525 2
526 2
527 2
528 1
529 3
530 2
531 2
532 1
533 4
534 8
535 1
536 2
537 4
538 2
539 2
540 1
541 1
542 1
543 1
544 2
545 3
546 1
547 2
548 4
549 2
550 1
552 2
553 3
554 3
555 3
556 5
557 4
558 2
559 4
561 3
562 4
563 1
564 4
567 3
569 2
570 2
571 1
572 3
573 1
574 6
575 3
576 2
577 2
578 2
579 1
580 4
581 4
582 3
583 1
584 3
585 3
586 1
587 2
588 2
589 2
590 1
591 3
592 1
593 2
594 6
595 4
596 6
597 3
598 2
599 2
601 5
603 2
604 5
605 2
606 2
607 3
608 2
609 5
610 1
611 2
612 2
613 4
616 1
617 2
618 1
619 1
620 2
621 2
622 1
623 1
624 3
625 5
626 1
627 2
628 4
630 1
631 2
632 2
633 4
635 4
636 3
637 2
638 2
639 4
640 3
641 1
642 2
644 1
645 4
646 4
647 2
648 1
649 2
650 2
651 2
652 3
653 2
654 4
655 1
656 2
657 1
658 2
659 3
660 1
661 5
662 1
663 3
664 3
665 1
666 2
667 1
668 1
671 1
672 2
673 1
674 1
675 1
677 2
678 2
679 3
680 1
682 4
684 2
685 1
686 1
687 1
688 2
689 1
690 1
691 1
694 4
695 2
696 2
697 1
699 2
700 2
702 1
703 1
704 1
705 1
706 1
707 1
712 1
713 3
714 1
715 1
716 2
717 1
718 1
719 2
720 2
721 3
722 2
723 1
724 2
725 1
729 1
730 1
731 1
732 3
733 2
735 1
736 2
737 1
738 1
739 1
741 1
744 3
746 2
747 1
748 1
749 1
750 1
751 1
752 1
753 2
754 1
755 1
756 1
760 1
761 1
763 3
764 1
765 1
766 1
767 1
768 2
770 3
771 4
772 1
774 1
775 1
777 1
778 1
779 1
780 2
782 1
784 2
789 1
790 1
792 2
793 4
794 1
797 1
800 1
802 2
803 1
804 1
806 2
807 1
808 3
809 2
810 3
811 3
813 1
814 1
815 1
816 1
817 1
818 2
819 1
820 1
821 1
822 1
823 1
824 3
828 1
829 2
832 1
835 3
836 1
837 2
838 1
840 1
844 1
847 2
849 1
850 1
852 1
854 3
858 1
859 2
861 1
862 1
863 3
864 1
866 1
867 2
869 2
871 1
872 1
873 2
876 4
878 2
880 1
882 2
885 2
886 1
887 1
889 1
890 1
891 1
892 1
895 2
897 1
898 2
899 1
902 2
903 1
905 2
907 2
909 2
910 1
911 1
912 1
917 1
918 1
921 1
922 2
923 2
927 2
928 1
930 1
932 1
937 1
939 1
940 1
944 1
945 1
947 1
951 2
952 1
953 2
956 2
959 1
961 1
963 1
964 2
965 2
967 1
970 1
971 1
981 2
982 2
984 2
985 1
986 1
989 1
990 1
992 1
993 2
994 1
995 1
996 1
997 1
998 1
1000 2
1002 1
1003 1
1004 2
1005 1
1012 1
1013 1
1017 1
1021 2
1022 1
1025 1
1027 1
1030 1
1031 2
1033 2
1034 1
1036 1
1037 1
1038 2
1040 1
1041 1
1046 1
1051 1
1053 1
1056 1
1058 1
1061 1
1062 1
1063 2
1065 1
1067 1
1069 2
1070 1
1072 1
1073 1
1074 1
1075 1
1077 1
1079 1
1082 1
1083 1
1084 2
1086 1
1093 1
1095 2
1096 1
1099 1
1101 1
1109 1
1110 1
1115 1
1122 1
1124 2
1125 1
1127 1
1130 1
1132 1
1139 2
1140 2
1142 1
1143 1
1149 1
1151 1
1153 2
1156 1
1158 1
1162 1
1163 1
1164 1
1167 2
1168 1
1170 1
1177 1
1180 1
1183 1
1185 1
1189 2
1200 1
1202 1
1203 1
1204 1
1206 1
1212 2
1215 1
1216 1
1217 2
1218 1
1219 1
1224 1
1225 1
1228 1
1231 1
1238 1
1243 1
1246 1
1249 1
1259 1
1264 1
1269 2
1274 1
1283 1
1284 1
1286 1
1288 1
1289 1
1295 1
1305 1
1313 1
1317 1
1319 1
1326 1
1328 1
1341 1
1345 1
1350 1
1351 1
1354 2
1359 1
1365 1
1371 1
1375 1
1386 1
1388 1
1394 1
1422 1
1426 1
1427 1
1433 1
1435 1
1438 1
1439 1
1445 1
1452 1
1456 2
1462 1
1465 1
1472 1
1476 1
1478 1
1485 1
1486 1
1487 1
1492 1
1493 1
1499 1
1516 1
1533 1
1535 1
1536 1
1549 1
1550 1
1556 1
1558 1
1569 1
1588 2
1609 1
1629 1
1630 1
1644 2
1649 1
1652 1
1660 1
1686 2
1689 1
1692 1
1703 1
1712 1
1713 1
1719 1
1727 1
1730 1
1738 1
1741 1
1757 1
1759 1
1762 1
1772 1
1792 1
1824 1
1831 1
1833 1
1847 1
1855 1
1870 1
1878 1
1880 1
1900 1
1920 1
1924 1
1927 1
1934 2
1941 1
1970 1
1977 1
1987 1
1991 1
1999 1
2013 1
2016 1
2034 1
2036 1
2046 1
2047 1
2050 1
2054 1
2072 1
2076 1
2103 1
2108 1
2152 1
2154 1
2173 1
2176 1
2184 1
2186 1
2188 1
2236 1
2273 1
2282 1
2296 1
2414 1
2417 1
2443 1
2489 1
2548 1
2558 1
2570 2
2586 1
2590 1
2676 1
2690 1
2697 2
2714 1
2732 1
2736 1
2859 1
2900 1
2906 1
2935 1
2941 1
2965 1
2969 1
3049 1
3104 1
3109 1
3177 1
3432 1
3478 1
3536 1
3644 1
3663 1
4052 1
4500 1
4782 1
5341 1
5798 1
5871 1
5948 1
6559 1
6926 1
sample size: 1000000
sample size: 2000000
sample size: 3000000
sample size: 4000000
sample size: 5000000
sample size: 6000000
sample size: 7000000
sample size: 8000000
sample size: 9000000
sample size: 10000000
sample size: 11000000
sample size: 12000000
sample size: 13000000
sample size: 14000000
sample size: 15000000
sample size: 16000000
sample size: 17000000
sample size: 18000000
sample size: 19000000
sample size: 20000000
sample size: 21000000
sample size: 22000000
sample size: 23000000
sample size: 24000000
sample size: 25000000
sample size: 26000000
sample size: 27000000
sample size: 28000000
sample size: 29000000
sample size: 30000000
Command completed. Elapsed time: 0:02:54. Running peak memory: 4.061GB.
PID: 389719; Command: preseq; Return code: 0; Memory used: 0.005GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt`
> `preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (390092)
BAM_INPUT
TOTAL READS = 30468400
DISTINCT READS = 1.6294e+07
DISTINCT COUNTS = 1118
MAX COUNT = 6926
COUNTS OF 1 = 1.31032e+07
MAX TERMS = 100
OBSERVED COUNTS (6927)
1 13103248
2 1726484
3 540128
4 254315
5 147467
6 96195
7 68125
8 50567
9 38638
10 30601
11 24915
12 20508
13 17467
14 14643
15 12769
16 11038
17 9701
18 8575
19 7601
20 6875
21 6210
22 5518
23 5088
24 4592
25 4188
26 3754
27 3445
28 3289
29 3024
30 2717
31 2588
32 2388
33 2274
34 2083
35 1899
36 1954
37 1666
38 1757
39 1529
40 1529
41 1388
42 1291
43 1263
44 1190
45 1148
46 1044
47 1022
48 1000
49 892
50 889
51 866
52 835
53 786
54 762
55 698
56 720
57 663
58 663
59 576
60 563
61 564
62 562
63 446
64 491
65 459
66 481
67 422
68 461
69 374
70 387
71 407
72 394
73 365
74 388
75 349
76 317
77 319
78 327
79 317
80 292
81 306
82 282
83 283
84 271
85 249
86 243
87 263
88 248
89 234
90 226
91 209
92 214
93 208
94 191
95 187
96 197
97 195
98 194
99 182
100 187
101 170
102 173
103 179
104 162
105 134
106 142
107 138
108 143
109 124
110 141
111 156
112 146
113 122
114 126
115 121
116 124
117 113
118 117
119 121
120 107
121 116
122 129
123 104
124 107
125 103
126 94
127 90
128 79
129 94
130 103
131 94
132 97
133 92
134 78
135 84
136 98
137 73
138 78
139 73
140 76
141 82
142 77
143 62
144 71
145 84
146 65
147 79
148 62
149 69
150 73
151 63
152 65
153 64
154 59
155 62
156 65
157 56
158 60
159 46
160 60
161 50
162 47
163 55
164 47
165 41
166 54
167 55
168 49
169 49
170 48
171 50
172 64
173 52
174 36
175 56
176 42
177 45
178 42
179 40
180 37
181 32
182 57
183 46
184 41
185 39
186 43
187 37
188 37
189 35
190 32
191 37
192 48
193 31
194 31
195 36
196 34
197 32
198 32
199 32
200 37
201 35
202 31
203 30
204 22
205 38
206 32
207 34
208 27
209 15
210 22
211 18
212 29
213 32
214 30
215 33
216 32
217 36
218 17
219 20
220 23
221 19
222 36
223 22
224 26
225 28
226 25
227 26
228 28
229 18
230 23
231 29
232 24
233 20
234 28
235 30
236 23
237 14
238 19
239 16
240 10
241 9
242 22
243 29
244 17
245 18
246 11
247 17
248 23
249 15
250 19
251 13
252 16
253 28
254 20
255 14
256 16
257 11
258 14
259 13
260 9
261 16
262 15
263 14
264 16
265 15
266 12
267 17
268 17
269 20
270 11
271 15
272 17
273 12
274 15
275 15
276 29
277 15
278 14
279 22
280 11
281 13
282 19
283 9
284 15
285 17
286 9
287 16
288 16
289 10
290 8
291 15
292 10
293 8
294 10
295 14
296 11
297 12
298 14
299 3
300 14
301 12
302 12
303 14
304 5
305 18
306 10
307 9
308 8
309 16
310 13
311 16
312 10
313 11
314 14
315 11
316 16
317 7
318 9
319 10
320 10
321 7
322 6
323 9
324 10
325 11
326 10
327 12
328 16
329 6
330 8
331 6
332 10
333 7
334 9
335 7
336 10
337 5
338 8
339 5
340 5
341 5
342 6
343 6
344 9
345 3
346 13
347 11
348 2
349 5
350 10
351 7
352 6
353 6
354 6
355 6
356 8
357 9
358 8
359 9
360 2
361 6
362 7
363 6
364 2
365 2
366 5
367 6
368 6
369 7
370 4
371 3
372 3
373 10
374 8
375 7
376 5
377 4
378 5
379 3
380 6
381 3
382 4
383 6
384 4
385 1
386 5
387 3
388 5
389 8
390 3
391 5
392 3
393 5
394 2
395 7
396 3
397 6
398 7
399 3
400 3
401 3
402 5
403 3
404 7
405 6
406 1
407 7
408 7
409 6
410 5
411 7
412 2
413 6
414 9
415 3
416 3
417 4
418 5
419 3
420 6
421 1
422 4
423 5
424 7
425 4
426 5
427 7
428 4
429 7
430 6
431 11
432 7
433 3
434 5
435 7
436 4
437 3
438 6
439 4
440 2
441 5
442 6
443 5
444 3
445 3
446 3
447 5
448 4
449 7
450 2
451 5
452 3
453 6
454 2
455 4
456 5
457 8
458 4
459 5
460 3
461 3
462 1
463 4
464 3
465 4
466 1
467 2
468 6
469 4
470 4
471 3
472 3
473 4
474 2
475 2
476 4
477 1
478 6
479 4
480 1
481 5
482 1
483 4
484 2
486 4
487 2
488 5
489 4
490 6
491 3
492 5
493 8
494 2
495 3
496 1
497 2
498 5
499 1
500 4
501 6
502 4
503 1
504 1
505 4
506 4
507 1
508 4
509 2
510 3
511 2
513 6
514 2
515 2
516 6
517 7
518 2
519 3
520 1
521 6
522 2
523 5
524 1
525 2
526 2
527 2
528 1
529 3
530 2
531 2
532 1
533 4
534 8
535 1
536 2
537 4
538 2
539 2
540 1
541 1
542 1
543 1
544 2
545 3
546 1
547 2
548 4
549 2
550 1
552 2
553 3
554 3
555 3
556 5
557 4
558 2
559 4
561 3
562 4
563 1
564 4
567 3
569 2
570 2
571 1
572 3
573 1
574 6
575 3
576 2
577 2
578 2
579 1
580 4
581 4
582 3
583 1
584 3
585 3
586 1
587 2
588 2
589 2
590 1
591 3
592 1
593 2
594 6
595 4
596 6
597 3
598 2
599 2
601 5
603 2
604 5
605 2
606 2
607 3
608 2
609 5
610 1
611 2
612 2
613 4
616 1
617 2
618 1
619 1
620 2
621 2
622 1
623 1
624 3
625 5
626 1
627 2
628 4
630 1
631 2
632 2
633 4
635 4
636 3
637 2
638 2
639 4
640 3
641 1
642 2
644 1
645 4
646 4
647 2
648 1
649 2
650 2
651 2
652 3
653 2
654 4
655 1
656 2
657 1
658 2
659 3
660 1
661 5
662 1
663 3
664 3
665 1
666 2
667 1
668 1
671 1
672 2
673 1
674 1
675 1
677 2
678 2
679 3
680 1
682 4
684 2
685 1
686 1
687 1
688 2
689 1
690 1
691 1
694 4
695 2
696 2
697 1
699 2
700 2
702 1
703 1
704 1
705 1
706 1
707 1
712 1
713 3
714 1
715 1
716 2
717 1
718 1
719 2
720 2
721 3
722 2
723 1
724 2
725 1
729 1
730 1
731 1
732 3
733 2
735 1
736 2
737 1
738 1
739 1
741 1
744 3
746 2
747 1
748 1
749 1
750 1
751 1
752 1
753 2
754 1
755 1
756 1
760 1
761 1
763 3
764 1
765 1
766 1
767 1
768 2
770 3
771 4
772 1
774 1
775 1
777 1
778 1
779 1
780 2
782 1
784 2
789 1
790 1
792 2
793 4
794 1
797 1
800 1
802 2
803 1
804 1
806 2
807 1
808 3
809 2
810 3
811 3
813 1
814 1
815 1
816 1
817 1
818 2
819 1
820 1
821 1
822 1
823 1
824 3
828 1
829 2
832 1
835 3
836 1
837 2
838 1
840 1
844 1
847 2
849 1
850 1
852 1
854 3
858 1
859 2
861 1
862 1
863 3
864 1
866 1
867 2
869 2
871 1
872 1
873 2
876 4
878 2
880 1
882 2
885 2
886 1
887 1
889 1
890 1
891 1
892 1
895 2
897 1
898 2
899 1
902 2
903 1
905 2
907 2
909 2
910 1
911 1
912 1
917 1
918 1
921 1
922 2
923 2
927 2
928 1
930 1
932 1
937 1
939 1
940 1
944 1
945 1
947 1
951 2
952 1
953 2
956 2
959 1
961 1
963 1
964 2
965 2
967 1
970 1
971 1
981 2
982 2
984 2
985 1
986 1
989 1
990 1
992 1
993 2
994 1
995 1
996 1
997 1
998 1
1000 2
1002 1
1003 1
1004 2
1005 1
1012 1
1013 1
1017 1
1021 2
1022 1
1025 1
1027 1
1030 1
1031 2
1033 2
1034 1
1036 1
1037 1
1038 2
1040 1
1041 1
1046 1
1051 1
1053 1
1056 1
1058 1
1061 1
1062 1
1063 2
1065 1
1067 1
1069 2
1070 1
1072 1
1073 1
1074 1
1075 1
1077 1
1079 1
1082 1
1083 1
1084 2
1086 1
1093 1
1095 2
1096 1
1099 1
1101 1
1109 1
1110 1
1115 1
1122 1
1124 2
1125 1
1127 1
1130 1
1132 1
1139 2
1140 2
1142 1
1143 1
1149 1
1151 1
1153 2
1156 1
1158 1
1162 1
1163 1
1164 1
1167 2
1168 1
1170 1
1177 1
1180 1
1183 1
1185 1
1189 2
1200 1
1202 1
1203 1
1204 1
1206 1
1212 2
1215 1
1216 1
1217 2
1218 1
1219 1
1224 1
1225 1
1228 1
1231 1
1238 1
1243 1
1246 1
1249 1
1259 1
1264 1
1269 2
1274 1
1283 1
1284 1
1286 1
1288 1
1289 1
1295 1
1305 1
1313 1
1317 1
1319 1
1326 1
1328 1
1341 1
1345 1
1350 1
1351 1
1354 2
1359 1
1365 1
1371 1
1375 1
1386 1
1388 1
1394 1
1422 1
1426 1
1427 1
1433 1
1435 1
1438 1
1439 1
1445 1
1452 1
1456 2
1462 1
1465 1
1472 1
1476 1
1478 1
1485 1
1486 1
1487 1
1492 1
1493 1
1499 1
1516 1
1533 1
1535 1
1536 1
1549 1
1550 1
1556 1
1558 1
1569 1
1588 2
1609 1
1629 1
1630 1
1644 2
1649 1
1652 1
1660 1
1686 2
1689 1
1692 1
1703 1
1712 1
1713 1
1719 1
1727 1
1730 1
1738 1
1741 1
1757 1
1759 1
1762 1
1772 1
1792 1
1824 1
1831 1
1833 1
1847 1
1855 1
1870 1
1878 1
1880 1
1900 1
1920 1
1924 1
1927 1
1934 2
1941 1
1970 1
1977 1
1987 1
1991 1
1999 1
2013 1
2016 1
2034 1
2036 1
2046 1
2047 1
2050 1
2054 1
2072 1
2076 1
2103 1
2108 1
2152 1
2154 1
2173 1
2176 1
2184 1
2186 1
2188 1
2236 1
2273 1
2282 1
2296 1
2414 1
2417 1
2443 1
2489 1
2548 1
2558 1
2570 2
2586 1
2590 1
2676 1
2690 1
2697 2
2714 1
2732 1
2736 1
2859 1
2900 1
2906 1
2935 1
2941 1
2965 1
2969 1
3049 1
3104 1
3109 1
3177 1
3432 1
3478 1
3536 1
3644 1
3663 1
4052 1
4500 1
4782 1
5341 1
5798 1
5871 1
5948 1
6559 1
6926 1
[ESTIMATING YIELD CURVE]
[BOOTSTRAPPING HISTOGRAM]
..__......................................................................................._...........
[COMPUTING CONFIDENCE INTERVALS]
[WRITING OUTPUT]
Command completed. Elapsed time: 0:02:57. Running peak memory: 4.061GB.
PID: 390092; Command: preseq; Return code: 0; Memory used: 0.005GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt`
> `echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt` (390311)
Command completed. Elapsed time: 0:00:42. Running peak memory: 4.061GB.
PID: 390311; Command: echo; Return code: 0; Memory used: 0.006GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot` (390629)
Processing Jurkat_ChRO-seq_2
INFO: Found real counts for Jurkat_ChRO-seq_2 - Total (M): 33.989659 Unique (M): 30.4684
Library complexity plot completed!
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 390629; Command: Rscript; Return code: 0; Memory used: 0.286GB
> `Library complexity` QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf Library complexity QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png PEPPRO _OBJ_
Missing stat 'Frac_exp_unique_at_10M'
> `grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt | awk '{print $2}'`
> `Frac_exp_unique_at_10M` 0.646 PEPPRO _RES_
### Calculate NRF, PBC1, and PBC2 (06-15 08:40:15) elapsed: 397.0 _TIME_
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam.bai`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv`
> `/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` (390651)
Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmp_Jurkat_ChRO-seq_2_sort_2eb60nhd'
Processing with 12 cores...
Discarding 98 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1']
Keeping 97 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:39. Running peak memory: 4.061GB.
PID: 390651; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.617GB
> `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv`
> `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv`
> `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv`
> `NRF` 0.53 PEPPRO _RES_
> `PBC1` 0.8 PEPPRO _RES_
> `PBC2` 8.39 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam`
> `samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam` (390713)
Command completed. Elapsed time: 0:00:09. Running peak memory: 4.061GB.
PID: 390713; Command: samtools; Return code: 0; Memory used: 0.009GB
> `samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam`
> `Unmapped_reads` 2435871 PEPPRO _RES_
### Split BAM by strand (06-15 08:41:10) elapsed: 55.0 _TIME_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam`
> `samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` (390797)
Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB.
PID: 390797; Command: samtools; Return code: 0; Memory used: 0.006GB
> `samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` (390917)
Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB.
PID: 390917; Command: samtools; Return code: 0; Memory used: 0.006GB
### Calculate TSS enrichment (06-15 08:44:34) elapsed: 204.0 _TIME_
Missing stat 'TSS_non-coding_score'
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv`
> `sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed` (391064)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391064; Command: sed; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt`
> `/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt` (391065)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 391065; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.553GB
> `TSS_coding_score` 68.4 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt`
> `/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt` (391102)
Command completed. Elapsed time: 0:00:10. Running peak memory: 4.061GB.
PID: 391102; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.548GB
> `TSS_non-coding_score` 23.2 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt` (391139)
Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt
`geom_smooth()` using formula 'y ~ x'
`geom_smooth()` using formula 'y ~ x'
`geom_smooth()` using formula 'y ~ x'
`geom_smooth()` using formula 'y ~ x'
TSS enrichment plot completed!
Command completed. Elapsed time: 0:00:06. Running peak memory: 4.061GB.
PID: 391139; Command: Rscript; Return code: 0; Memory used: 0.316GB
> `TSS enrichment` QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.png PEPPRO _OBJ_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt`
> `samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt` (391385,391386,391387,391388)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391385; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 391387; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 391386; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 391388; Command: awk; Return code: 0; Memory used: 0.0GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt` (391390)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391390; Command: cut; Return code: 0; Memory used: 0.0GB
### Calculate Pause Index (PI) (06-15 08:45:03) elapsed: 29.0 _TIME_
Missing stat 'Pause_index'
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed`
> `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed` (391393,391394)
Command completed. Elapsed time: 0:00:02. Running peak memory: 4.061GB.
PID: 391393; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 391394; Command: bedtools; Return code: 0; Memory used: 0.099GB
> `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed` (391399,391400)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391399; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 391400; Command: bedtools; Return code: 0; Memory used: 0.005GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed`
> `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed` (391402,391403,391404,391405)
Command completed. Elapsed time: 0:00:46. Running peak memory: 4.061GB.
PID: 391405; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 391402; Command: bedtools; Return code: 0; Memory used: 0.029GB
PID: 391404; Command: sort; Return code: 0; Memory used: 0.012GB
PID: 391403; Command: awk; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed`
> `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed` (391448,391449,391450)
Command completed. Elapsed time: 0:00:58. Running peak memory: 4.061GB.
PID: 391448; Command: bedtools; Return code: 0; Memory used: 0.099GB
PID: 391450; Command: sort; Return code: 0; Memory used: 0.009GB
PID: 391449; Command: awk; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed`
> `join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v` (391500,391501,391502)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391500; Command: join; Return code: 0; Memory used: 0.001GB
PID: 391502; Command: env; Return code: 0; Memory used: 0.004GB
PID: 391501; Command: awk; Return code: 0; Memory used: 0.001GB
> `awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}'`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed`
> `awk -v OFS=' ' '{ if ($5 > 0.0241981) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391509)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391509; Command: awk; Return code: 0; Memory used: 0.002GB
> `sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'`
> `Pause_index` 85.85 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391514)
Pause index plot completed!
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 391514; Command: Rscript; Return code: 0; Memory used: 0.318GB
> `Pause index` QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf Pause index QC_hg38/Jurkat_ChRO-seq_2_pause_index.png PEPPRO _OBJ_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed.gz`
> `pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391535)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391535; Command: pigz; Return code: 0; Memory used: 0.004GB
### Calculate Fraction of Reads in pre-mature mRNA (06-15 08:46:55) elapsed: 112.0 _TIME_
Missing stat 'Plus_FRiP'
> `samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam`
34004054 12298505
> `Plus_FRiP` 0.36 PEPPRO _RES_
Missing stat 'Minus_FRiP'
> `samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam`
34004054 11929067
> `Minus_FRiP` 0.35 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed`
> `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed` (391688,391689)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391688; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 391689; Command: bedtools; Return code: 0; Memory used: 0.006GB
> `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed` (391691)
Command completed. Elapsed time: 0:00:59. Running peak memory: 4.061GB.
PID: 391691; Command: bedtools; Return code: 0; Memory used: 0.1GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed`
> `ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz` (391745)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391745; Command: ln; Return code: 0; Memory used: 0.002GB
> `pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed` (391746)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391746; Command: pigz; Return code: 0; Memory used: 0.002GB
### Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 08:48:56) elapsed: 121.0 _TIME_
> `cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed | sort -u`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer`
> `awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed` (391754)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391754; Command: awk; Return code: 0; Memory used: 0.002GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed` (391756,391757,391758,391759)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391756; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 391757; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 391759; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 391758; Command: cut; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed` (391762)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 391762; Command: bedtools; Return code: 0; Memory used: 0.008GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed` (391857)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 391857; Command: bedtools; Return code: 0; Memory used: 0.009GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed` (391890,391891,391892,391893)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391890; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 391891; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 391893; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 391892; Command: cut; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed` (391895)
Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB.
PID: 391895; Command: bedtools; Return code: 0; Memory used: 0.056GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed` (391998)
Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB.
PID: 391998; Command: bedtools; Return code: 0; Memory used: 0.047GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region`
> `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region"` (392261)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392261; Command: mv; Return code: 0; Memory used: 0.0GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed` (392262,392263,392264,392265)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392262; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392264; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392263; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392265; Command: bedtools; Return code: 0; Memory used: 0.012GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed` (392268)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392268; Command: bedtools; Return code: 0; Memory used: 0.011GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed` (392304)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392304; Command: bedtools; Return code: 0; Memory used: 0.019GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR`
> `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR"` (392339)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392339; Command: mv; Return code: 0; Memory used: 0.0GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed` (392340,392341,392342,392343)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392340; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392341; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392343; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 392342; Command: cut; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed` (392345)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392345; Command: bedtools; Return code: 0; Memory used: 0.036GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed` (392379)
Command completed. Elapsed time: 0:00:21. Running peak memory: 4.061GB.
PID: 392379; Command: bedtools; Return code: 0; Memory used: 0.029GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR`
> `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR"` (392415)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392415; Command: mv; Return code: 0; Memory used: 0.0GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed` (392416,392417,392418,392419)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392416; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392417; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392419; Command: bedtools; Return code: 0; Memory used: 0.036GB
PID: 392418; Command: cut; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed` (392422)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392422; Command: bedtools; Return code: 0; Memory used: 0.015GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed` (392448)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392448; Command: bedtools; Return code: 0; Memory used: 0.017GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed` (392494,392495,392496,392497)
Command completed. Elapsed time: 0:00:03. Running peak memory: 4.061GB.
PID: 392494; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392495; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392497; Command: bedtools; Return code: 0; Memory used: 0.173GB
PID: 392496; Command: cut; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed` (392502)
Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB.
PID: 392502; Command: bedtools; Return code: 0; Memory used: 0.064GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed` (392524)
Command completed. Elapsed time: 0:00:23. Running peak memory: 4.061GB.
PID: 392524; Command: bedtools; Return code: 0; Memory used: 0.036GB
Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed`
> `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed` (392560,392561,392562,392563)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392560; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392562; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392561; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392563; Command: bedtools; Return code: 0; Memory used: 0.083GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392566)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392566; Command: bedtools; Return code: 0; Memory used: 0.068GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed`
> `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed` (392597)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392597; Command: bedtools; Return code: 0; Memory used: 0.072GB
### Plot cFRiF/FRiF (06-15 08:54:07) elapsed: 311.0 _TIME_
> `samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam`
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392635)
Cumulative cfrif plot completed!
Command completed. Elapsed time: 0:00:36. Running peak memory: 4.061GB.
PID: 392635; Command: Rscript; Return code: 0; Memory used: 0.467GB
> `cFRiF` QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf cFRiF QC_hg38/Jurkat_ChRO-seq_2_cFRiF.png PEPPRO _OBJ_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392790)
Cumulative frif plot completed!
Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB.
PID: 392790; Command: Rscript; Return code: 0; Memory used: 0.469GB
> `FRiF` QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf FRiF QC_hg38/Jurkat_ChRO-seq_2_FRiF.png PEPPRO _OBJ_
### Calculate mRNA contamination (06-15 08:55:11) elapsed: 64.0 _TIME_
Missing stat 'mRNA_contamination'
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed`
> `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed` (393034,393035)
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393035; Command: bedtools; Return code: 0; Memory used: 0.097GB
PID: 393034; Command: grep; Return code: 0; Memory used: 0.004GB
> `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed` (393080,393081,393082)
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393080; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 393082; Command: bedtools; Return code: 0; Memory used: 0.003GB
PID: 393081; Command: bedtools; Return code: 0; Memory used: 0.037GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed`
> `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed` (393089)
Command completed. Elapsed time: 0:00:38. Running peak memory: 4.061GB.
PID: 393089; Command: bedtools; Return code: 0; Memory used: 0.032GB
> `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed` (393166)
Command completed. Elapsed time: 0:00:43. Running peak memory: 4.061GB.
PID: 393166; Command: bedtools; Return code: 0; Memory used: 0.059GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed`
> `awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed` (393768,393769,393770)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 393768; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 393770; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 393769; Command: awk; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed`
> `awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed` (393773,393774,393775)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 393773; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 393775; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 393774; Command: awk; Return code: 0; Memory used: 0.001GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed`
> `join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed` (393777,393778,393779)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 393777; Command: join; Return code: 0; Memory used: 0.001GB
PID: 393779; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 393778; Command: awk; Return code: 0; Memory used: 0.001GB
> `awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'`
> `mRNA_contamination` 1.2 PEPPRO _RES_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf`
> `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed --annotate` (393786)
mRNA contamination plot completed!
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393786; Command: Rscript; Return code: 0; Memory used: 0.316GB
> `mRNA contamination` QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf mRNA contamination QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.png PEPPRO _OBJ_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed.gz`
> `pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed` (393816)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 393816; Command: pigz; Return code: 0; Memory used: 0.005GB
### Produce bigWig files (06-15 08:56:48) elapsed: 98.0 _TIME_
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw`
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` (393824)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 393824; Command: samtools; Return code: 0; Memory used: 0.007GB
> `/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0` (393843)
Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_plus_cuttrace_ywx6rsj8'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 114 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2']
Keeping 81 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270591v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw'
Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:41. Running peak memory: 4.061GB.
PID: 393843; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.705GB
Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw`
> `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` (396260)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 396260; Command: samtools; Return code: 0; Memory used: 0.007GB
> `/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0` (396271)
Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_minus_cuttrace_43w60_dz'
Processing with 4 cores...
stdin is empty of data
Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270719v1_random', 'chr14_KI270722v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1']
Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_GL000194v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw'
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:35. Running peak memory: 4.061GB.
PID: 396271; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.618GB
### Pipeline completed. Epilogue
* Elapsed time (this run): 1:55:16
* Total elapsed time (all runs): 2:23:22
* Peak memory (this run): 4.0615 GB
* Pipeline completed time: 2020-06-15 09:12:28