Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_2 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-32c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/
  • Pipeline started at: (06-15 07:17:12) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR7616134.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: Jurkat_ChRO-seq_2
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 6
  • verbosity: None

Local input file: /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz

File_mb 1914.91 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz

ln -sf /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz (380685)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 380685; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq (380689)


Command completed. Elapsed time: 0:02:57. Running peak memory: 0.002GB.
PID: 380689; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 49841170 PEPPRO RES

Fastq_reads 49841170 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz']

FASTQ processing: (06-15 07:21:39) elapsed: 266.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq

(cutadapt -j 12 -m 8 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt (381356)


Command completed. Elapsed time: 0:02:08. Running peak memory: 3.496GB.
PID: 381356; Command: cutadapt; Return code: 0; Memory used: 3.496GB

seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq (381610,381611)


Command completed. Elapsed time: 0:01:32. Running peak memory: 3.496GB.
PID: 381610; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 381611; Command: seqtk; Return code: 0; Memory used: 0.002GB

Evaluating read trimming

Trimmed_reads 48264585 PEPPRO RES

Trim_loss_rate 3.16 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq (382001)

Started analysis of Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 5% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 10% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 15% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 20% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 25% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 30% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 35% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 40% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 45% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 50% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 55% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 60% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 65% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 70% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 75% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 80% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 85% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 90% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Approx 95% complete for Jurkat_ChRO-seq_2_R1_processed.fastq
Analysis complete for Jurkat_ChRO-seq_2_R1_processed.fastq

A fatal error has been detected by the Java Runtime Environment:

SIGSEGV (0xb) at pc=0x00007efea9c3ba34, pid=382001, tid=0x00007efe8eff7700

JRE version: Java(TM) SE Runtime Environment (8.0_171-b11) (build 1.8.0_171-b11)

Java VM: Java HotSpot(TM) 64-Bit Server VM (25.171-b11 mixed mode linux-amd64 compressed oops)

Problematic frame:

V [libjvm.so+0xa35a34] NMethodSweeper::sweep_code_cache()+0x524

Core dump written. Default location: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/core or core.382001

An error report file with more information is saved as:

/sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/hs_err_pid382001.log

If you would like to submit a bug report, please visit:

http://bugreport.java.com/bugreport/crash.jsp

Command completed. Elapsed time: 0:01:52. Running peak memory: 3.496GB.
PID: 382001; Command: fastqc; Return code: -6; Memory used: 0.182GB

Subprocess returned nonzero result. Check above output for details ERROR: Subprocess returned nonzero result, but pipeline is continuing because nofail=True

FastQC report r1 fastqc/Jurkat_ChRO-seq_2_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq

seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq (382314)

[INFO] 5764233 duplicated records removed
Command completed. Elapsed time: 0:02:06. Running peak memory: 4.061GB.
PID: 382314; Command: seqkit; Return code: 0; Memory used: 4.061GB

seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq (382617,382618)


Command completed. Elapsed time: 0:01:00. Running peak memory: 4.061GB.
PID: 382617; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 382618; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 42416468.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 223715.0 PEPPRO RES

Duplicate_reads 5764233.0 PEPPRO RES

Pct_uninformative_adapter_reads 0.4489 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag (383074)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 383074; Command: touch; Return code: 0; Memory used: 0.002GB

Plot adapter insertion distribution (06-15 07:32:20) elapsed: 641.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt -u 6 (383075)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 383075; Command: Rscript; Return code: 0; Memory used: 0.316GB

Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 39 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:32:24) elapsed: 5.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.4899 PEPPRO RES

Prealignments (06-15 07:32:24) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:32:24) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 48264585 reads; of these: 48264585 (100.00%) were unpaired; of these: 44313938 (91.81%) aligned 0 times 3950647 (8.19%) aligned exactly 1 time 0 (0.00%) aligned >1 times 8.19% overall alignment rate

Aligned_reads_human_rDNA 3950647.0 PEPPRO RES

Alignment_rate_human_rDNA 8.19 PEPPRO RES

Map to human_rDNA (06-15 07:37:49) elapsed: 325.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq 2>&1 > /dev/null)

Map to genome (06-15 07:42:21) elapsed: 272.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam (384181,384182,384183)

44313938 reads; of these:
  44313938 (100.00%) were unpaired; of these:
    2435871 (5.50%) aligned 0 times
    29426081 (66.40%) aligned exactly 1 time
    12451986 (28.10%) aligned >1 times
94.50% overall alignment rate
[bam_sort_core] merging from 12 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:17:27. Running peak memory: 4.061GB.
PID: 384181; Command: bowtie2; Return code: 0; Memory used: 3.689GB
PID: 384182; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 384183; Command: samtools; Return code: 0; Memory used: 0.898GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam (385717)


Command completed. Elapsed time: 0:01:10. Running peak memory: 4.061GB.
PID: 385717; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 41878067 PEPPRO RES

QC_filtered_reads 7874013 PEPPRO RES

Aligned_reads 34004054 PEPPRO RES

Alignment_rate 70.45 PEPPRO RES

Total_efficiency 68.22 PEPPRO RES

Read_depth 4.27 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam

bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam (387215,387216,387217)

39606611 reads; of these:
  39606611 (100.00%) were unpaired; of these:
    2278810 (5.75%) aligned 0 times
    26411590 (66.68%) aligned exactly 1 time
    10916211 (27.56%) aligned >1 times
94.25% overall alignment rate
[bam_sort_core] merging from 11 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:14:27. Running peak memory: 4.061GB.
PID: 387215; Command: bowtie2; Return code: 0; Memory used: 3.69GB
PID: 387216; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 387217; Command: samtools; Return code: 0; Memory used: 0.898GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam (389084)


Command completed. Elapsed time: 0:01:04. Running peak memory: 4.061GB.
PID: 389084; Command: samtools; Return code: 0; Memory used: 0.018GB

Compress all unmapped read files (06-15 08:28:56) elapsed: 2794.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq (389153)


Command completed. Elapsed time: 0:00:55. Running peak memory: 4.061GB.
PID: 389153; Command: pigz; Return code: 0; Memory used: 0.013GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam (389213)


Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB.
PID: 389213; Command: samtools; Return code: 0; Memory used: 0.011GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 18250 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam (389520)


Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB.
PID: 389520; Command: samtools; Return code: 0; Memory used: 0.012GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed (389540,389541,389542,389543)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 389541; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 389543; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 389540; Command: samtools; Return code: 0; Memory used: 0.01GB
PID: 389542; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam (389545)


Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB.
PID: 389545; Command: samtools; Return code: 0; Memory used: 0.018GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam (389588)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 389588; Command: mv; Return code: 0; Memory used: 0.001GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam (389589)


Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB.
PID: 389589; Command: samtools; Return code: 0; Memory used: 0.012GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 70 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam (389692)


Command completed. Elapsed time: 0:00:27. Running peak memory: 4.061GB.
PID: 389692; Command: samtools; Return code: 0; Memory used: 0.013GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam
No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam.bai

Calculate library complexity (06-15 08:33:38) elapsed: 282.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt

preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam (389719)

BAM_INPUT
TOTAL READS     = 30468400
COUNTS_SUM      = 30468400
DISTINCT READS  = 1.6294e+07
DISTINCT COUNTS = 1118
MAX COUNT       = 6926
COUNTS OF 1     = 1.31032e+07
OBSERVED COUNTS (6927)
1   13103248
2   1726484
3   540128
4   254315
5   147467
6   96195
7   68125
8   50567
9   38638
10  30601
11  24915
12  20508
13  17467
14  14643
15  12769
16  11038
17  9701
18  8575
19  7601
20  6875
21  6210
22  5518
23  5088
24  4592
25  4188
26  3754
27  3445
28  3289
29  3024
30  2717
31  2588
32  2388
33  2274
34  2083
35  1899
36  1954
37  1666
38  1757
39  1529
40  1529
41  1388
42  1291
43  1263
44  1190
45  1148
46  1044
47  1022
48  1000
49  892
50  889
51  866
52  835
53  786
54  762
55  698
56  720
57  663
58  663
59  576
60  563
61  564
62  562
63  446
64  491
65  459
66  481
67  422
68  461
69  374
70  387
71  407
72  394
73  365
74  388
75  349
76  317
77  319
78  327
79  317
80  292
81  306
82  282
83  283
84  271
85  249
86  243
87  263
88  248
89  234
90  226
91  209
92  214
93  208
94  191
95  187
96  197
97  195
98  194
99  182
100 187
101 170
102 173
103 179
104 162
105 134
106 142
107 138
108 143
109 124
110 141
111 156
112 146
113 122
114 126
115 121
116 124
117 113
118 117
119 121
120 107
121 116
122 129
123 104
124 107
125 103
126 94
127 90
128 79
129 94
130 103
131 94
132 97
133 92
134 78
135 84
136 98
137 73
138 78
139 73
140 76
141 82
142 77
143 62
144 71
145 84
146 65
147 79
148 62
149 69
150 73
151 63
152 65
153 64
154 59
155 62
156 65
157 56
158 60
159 46
160 60
161 50
162 47
163 55
164 47
165 41
166 54
167 55
168 49
169 49
170 48
171 50
172 64
173 52
174 36
175 56
176 42
177 45
178 42
179 40
180 37
181 32
182 57
183 46
184 41
185 39
186 43
187 37
188 37
189 35
190 32
191 37
192 48
193 31
194 31
195 36
196 34
197 32
198 32
199 32
200 37
201 35
202 31
203 30
204 22
205 38
206 32
207 34
208 27
209 15
210 22
211 18
212 29
213 32
214 30
215 33
216 32
217 36
218 17
219 20
220 23
221 19
222 36
223 22
224 26
225 28
226 25
227 26
228 28
229 18
230 23
231 29
232 24
233 20
234 28
235 30
236 23
237 14
238 19
239 16
240 10
241 9
242 22
243 29
244 17
245 18
246 11
247 17
248 23
249 15
250 19
251 13
252 16
253 28
254 20
255 14
256 16
257 11
258 14
259 13
260 9
261 16
262 15
263 14
264 16
265 15
266 12
267 17
268 17
269 20
270 11
271 15
272 17
273 12
274 15
275 15
276 29
277 15
278 14
279 22
280 11
281 13
282 19
283 9
284 15
285 17
286 9
287 16
288 16
289 10
290 8
291 15
292 10
293 8
294 10
295 14
296 11
297 12
298 14
299 3
300 14
301 12
302 12
303 14
304 5
305 18
306 10
307 9
308 8
309 16
310 13
311 16
312 10
313 11
314 14
315 11
316 16
317 7
318 9
319 10
320 10
321 7
322 6
323 9
324 10
325 11
326 10
327 12
328 16
329 6
330 8
331 6
332 10
333 7
334 9
335 7
336 10
337 5
338 8
339 5
340 5
341 5
342 6
343 6
344 9
345 3
346 13
347 11
348 2
349 5
350 10
351 7
352 6
353 6
354 6
355 6
356 8
357 9
358 8
359 9
360 2
361 6
362 7
363 6
364 2
365 2
366 5
367 6
368 6
369 7
370 4
371 3
372 3
373 10
374 8
375 7
376 5
377 4
378 5
379 3
380 6
381 3
382 4
383 6
384 4
385 1
386 5
387 3
388 5
389 8
390 3
391 5
392 3
393 5
394 2
395 7
396 3
397 6
398 7
399 3
400 3
401 3
402 5
403 3
404 7
405 6
406 1
407 7
408 7
409 6
410 5
411 7
412 2
413 6
414 9
415 3
416 3
417 4
418 5
419 3
420 6
421 1
422 4
423 5
424 7
425 4
426 5
427 7
428 4
429 7
430 6
431 11
432 7
433 3
434 5
435 7
436 4
437 3
438 6
439 4
440 2
441 5
442 6
443 5
444 3
445 3
446 3
447 5
448 4
449 7
450 2
451 5
452 3
453 6
454 2
455 4
456 5
457 8
458 4
459 5
460 3
461 3
462 1
463 4
464 3
465 4
466 1
467 2
468 6
469 4
470 4
471 3
472 3
473 4
474 2
475 2
476 4
477 1
478 6
479 4
480 1
481 5
482 1
483 4
484 2
486 4
487 2
488 5
489 4
490 6
491 3
492 5
493 8
494 2
495 3
496 1
497 2
498 5
499 1
500 4
501 6
502 4
503 1
504 1
505 4
506 4
507 1
508 4
509 2
510 3
511 2
513 6
514 2
515 2
516 6
517 7
518 2
519 3
520 1
521 6
522 2
523 5
524 1
525 2
526 2
527 2
528 1
529 3
530 2
531 2
532 1
533 4
534 8
535 1
536 2
537 4
538 2
539 2
540 1
541 1
542 1
543 1
544 2
545 3
546 1
547 2
548 4
549 2
550 1
552 2
553 3
554 3
555 3
556 5
557 4
558 2
559 4
561 3
562 4
563 1
564 4
567 3
569 2
570 2
571 1
572 3
573 1
574 6
575 3
576 2
577 2
578 2
579 1
580 4
581 4
582 3
583 1
584 3
585 3
586 1
587 2
588 2
589 2
590 1
591 3
592 1
593 2
594 6
595 4
596 6
597 3
598 2
599 2
601 5
603 2
604 5
605 2
606 2
607 3
608 2
609 5
610 1
611 2
612 2
613 4
616 1
617 2
618 1
619 1
620 2
621 2
622 1
623 1
624 3
625 5
626 1
627 2
628 4
630 1
631 2
632 2
633 4
635 4
636 3
637 2
638 2
639 4
640 3
641 1
642 2
644 1
645 4
646 4
647 2
648 1
649 2
650 2
651 2
652 3
653 2
654 4
655 1
656 2
657 1
658 2
659 3
660 1
661 5
662 1
663 3
664 3
665 1
666 2
667 1
668 1
671 1
672 2
673 1
674 1
675 1
677 2
678 2
679 3
680 1
682 4
684 2
685 1
686 1
687 1
688 2
689 1
690 1
691 1
694 4
695 2
696 2
697 1
699 2
700 2
702 1
703 1
704 1
705 1
706 1
707 1
712 1
713 3
714 1
715 1
716 2
717 1
718 1
719 2
720 2
721 3
722 2
723 1
724 2
725 1
729 1
730 1
731 1
732 3
733 2
735 1
736 2
737 1
738 1
739 1
741 1
744 3
746 2
747 1
748 1
749 1
750 1
751 1
752 1
753 2
754 1
755 1
756 1
760 1
761 1
763 3
764 1
765 1
766 1
767 1
768 2
770 3
771 4
772 1
774 1
775 1
777 1
778 1
779 1
780 2
782 1
784 2
789 1
790 1
792 2
793 4
794 1
797 1
800 1
802 2
803 1
804 1
806 2
807 1
808 3
809 2
810 3
811 3
813 1
814 1
815 1
816 1
817 1
818 2
819 1
820 1
821 1
822 1
823 1
824 3
828 1
829 2
832 1
835 3
836 1
837 2
838 1
840 1
844 1
847 2
849 1
850 1
852 1
854 3
858 1
859 2
861 1
862 1
863 3
864 1
866 1
867 2
869 2
871 1
872 1
873 2
876 4
878 2
880 1
882 2
885 2
886 1
887 1
889 1
890 1
891 1
892 1
895 2
897 1
898 2
899 1
902 2
903 1
905 2
907 2
909 2
910 1
911 1
912 1
917 1
918 1
921 1
922 2
923 2
927 2
928 1
930 1
932 1
937 1
939 1
940 1
944 1
945 1
947 1
951 2
952 1
953 2
956 2
959 1
961 1
963 1
964 2
965 2
967 1
970 1
971 1
981 2
982 2
984 2
985 1
986 1
989 1
990 1
992 1
993 2
994 1
995 1
996 1
997 1
998 1
1000    2
1002    1
1003    1
1004    2
1005    1
1012    1
1013    1
1017    1
1021    2
1022    1
1025    1
1027    1
1030    1
1031    2
1033    2
1034    1
1036    1
1037    1
1038    2
1040    1
1041    1
1046    1
1051    1
1053    1
1056    1
1058    1
1061    1
1062    1
1063    2
1065    1
1067    1
1069    2
1070    1
1072    1
1073    1
1074    1
1075    1
1077    1
1079    1
1082    1
1083    1
1084    2
1086    1
1093    1
1095    2
1096    1
1099    1
1101    1
1109    1
1110    1
1115    1
1122    1
1124    2
1125    1
1127    1
1130    1
1132    1
1139    2
1140    2
1142    1
1143    1
1149    1
1151    1
1153    2
1156    1
1158    1
1162    1
1163    1
1164    1
1167    2
1168    1
1170    1
1177    1
1180    1
1183    1
1185    1
1189    2
1200    1
1202    1
1203    1
1204    1
1206    1
1212    2
1215    1
1216    1
1217    2
1218    1
1219    1
1224    1
1225    1
1228    1
1231    1
1238    1
1243    1
1246    1
1249    1
1259    1
1264    1
1269    2
1274    1
1283    1
1284    1
1286    1
1288    1
1289    1
1295    1
1305    1
1313    1
1317    1
1319    1
1326    1
1328    1
1341    1
1345    1
1350    1
1351    1
1354    2
1359    1
1365    1
1371    1
1375    1
1386    1
1388    1
1394    1
1422    1
1426    1
1427    1
1433    1
1435    1
1438    1
1439    1
1445    1
1452    1
1456    2
1462    1
1465    1
1472    1
1476    1
1478    1
1485    1
1486    1
1487    1
1492    1
1493    1
1499    1
1516    1
1533    1
1535    1
1536    1
1549    1
1550    1
1556    1
1558    1
1569    1
1588    2
1609    1
1629    1
1630    1
1644    2
1649    1
1652    1
1660    1
1686    2
1689    1
1692    1
1703    1
1712    1
1713    1
1719    1
1727    1
1730    1
1738    1
1741    1
1757    1
1759    1
1762    1
1772    1
1792    1
1824    1
1831    1
1833    1
1847    1
1855    1
1870    1
1878    1
1880    1
1900    1
1920    1
1924    1
1927    1
1934    2
1941    1
1970    1
1977    1
1987    1
1991    1
1999    1
2013    1
2016    1
2034    1
2036    1
2046    1
2047    1
2050    1
2054    1
2072    1
2076    1
2103    1
2108    1
2152    1
2154    1
2173    1
2176    1
2184    1
2186    1
2188    1
2236    1
2273    1
2282    1
2296    1
2414    1
2417    1
2443    1
2489    1
2548    1
2558    1
2570    2
2586    1
2590    1
2676    1
2690    1
2697    2
2714    1
2732    1
2736    1
2859    1
2900    1
2906    1
2935    1
2941    1
2965    1
2969    1
3049    1
3104    1
3109    1
3177    1
3432    1
3478    1
3536    1
3644    1
3663    1
4052    1
4500    1
4782    1
5341    1
5798    1
5871    1
5948    1
6559    1
6926    1

sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 sample size: 19000000 sample size: 20000000 sample size: 21000000 sample size: 22000000 sample size: 23000000 sample size: 24000000 sample size: 25000000 sample size: 26000000 sample size: 27000000 sample size: 28000000 sample size: 29000000 sample size: 30000000 Command completed. Elapsed time: 0:02:54. Running peak memory: 4.061GB.
PID: 389719; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt

preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam (390092)

BAM_INPUT
TOTAL READS     = 30468400
DISTINCT READS  = 1.6294e+07
DISTINCT COUNTS = 1118
MAX COUNT       = 6926
COUNTS OF 1     = 1.31032e+07
MAX TERMS       = 100
OBSERVED COUNTS (6927)
1   13103248
2   1726484
3   540128
4   254315
5   147467
6   96195
7   68125
8   50567
9   38638
10  30601
11  24915
12  20508
13  17467
14  14643
15  12769
16  11038
17  9701
18  8575
19  7601
20  6875
21  6210
22  5518
23  5088
24  4592
25  4188
26  3754
27  3445
28  3289
29  3024
30  2717
31  2588
32  2388
33  2274
34  2083
35  1899
36  1954
37  1666
38  1757
39  1529
40  1529
41  1388
42  1291
43  1263
44  1190
45  1148
46  1044
47  1022
48  1000
49  892
50  889
51  866
52  835
53  786
54  762
55  698
56  720
57  663
58  663
59  576
60  563
61  564
62  562
63  446
64  491
65  459
66  481
67  422
68  461
69  374
70  387
71  407
72  394
73  365
74  388
75  349
76  317
77  319
78  327
79  317
80  292
81  306
82  282
83  283
84  271
85  249
86  243
87  263
88  248
89  234
90  226
91  209
92  214
93  208
94  191
95  187
96  197
97  195
98  194
99  182
100 187
101 170
102 173
103 179
104 162
105 134
106 142
107 138
108 143
109 124
110 141
111 156
112 146
113 122
114 126
115 121
116 124
117 113
118 117
119 121
120 107
121 116
122 129
123 104
124 107
125 103
126 94
127 90
128 79
129 94
130 103
131 94
132 97
133 92
134 78
135 84
136 98
137 73
138 78
139 73
140 76
141 82
142 77
143 62
144 71
145 84
146 65
147 79
148 62
149 69
150 73
151 63
152 65
153 64
154 59
155 62
156 65
157 56
158 60
159 46
160 60
161 50
162 47
163 55
164 47
165 41
166 54
167 55
168 49
169 49
170 48
171 50
172 64
173 52
174 36
175 56
176 42
177 45
178 42
179 40
180 37
181 32
182 57
183 46
184 41
185 39
186 43
187 37
188 37
189 35
190 32
191 37
192 48
193 31
194 31
195 36
196 34
197 32
198 32
199 32
200 37
201 35
202 31
203 30
204 22
205 38
206 32
207 34
208 27
209 15
210 22
211 18
212 29
213 32
214 30
215 33
216 32
217 36
218 17
219 20
220 23
221 19
222 36
223 22
224 26
225 28
226 25
227 26
228 28
229 18
230 23
231 29
232 24
233 20
234 28
235 30
236 23
237 14
238 19
239 16
240 10
241 9
242 22
243 29
244 17
245 18
246 11
247 17
248 23
249 15
250 19
251 13
252 16
253 28
254 20
255 14
256 16
257 11
258 14
259 13
260 9
261 16
262 15
263 14
264 16
265 15
266 12
267 17
268 17
269 20
270 11
271 15
272 17
273 12
274 15
275 15
276 29
277 15
278 14
279 22
280 11
281 13
282 19
283 9
284 15
285 17
286 9
287 16
288 16
289 10
290 8
291 15
292 10
293 8
294 10
295 14
296 11
297 12
298 14
299 3
300 14
301 12
302 12
303 14
304 5
305 18
306 10
307 9
308 8
309 16
310 13
311 16
312 10
313 11
314 14
315 11
316 16
317 7
318 9
319 10
320 10
321 7
322 6
323 9
324 10
325 11
326 10
327 12
328 16
329 6
330 8
331 6
332 10
333 7
334 9
335 7
336 10
337 5
338 8
339 5
340 5
341 5
342 6
343 6
344 9
345 3
346 13
347 11
348 2
349 5
350 10
351 7
352 6
353 6
354 6
355 6
356 8
357 9
358 8
359 9
360 2
361 6
362 7
363 6
364 2
365 2
366 5
367 6
368 6
369 7
370 4
371 3
372 3
373 10
374 8
375 7
376 5
377 4
378 5
379 3
380 6
381 3
382 4
383 6
384 4
385 1
386 5
387 3
388 5
389 8
390 3
391 5
392 3
393 5
394 2
395 7
396 3
397 6
398 7
399 3
400 3
401 3
402 5
403 3
404 7
405 6
406 1
407 7
408 7
409 6
410 5
411 7
412 2
413 6
414 9
415 3
416 3
417 4
418 5
419 3
420 6
421 1
422 4
423 5
424 7
425 4
426 5
427 7
428 4
429 7
430 6
431 11
432 7
433 3
434 5
435 7
436 4
437 3
438 6
439 4
440 2
441 5
442 6
443 5
444 3
445 3
446 3
447 5
448 4
449 7
450 2
451 5
452 3
453 6
454 2
455 4
456 5
457 8
458 4
459 5
460 3
461 3
462 1
463 4
464 3
465 4
466 1
467 2
468 6
469 4
470 4
471 3
472 3
473 4
474 2
475 2
476 4
477 1
478 6
479 4
480 1
481 5
482 1
483 4
484 2
486 4
487 2
488 5
489 4
490 6
491 3
492 5
493 8
494 2
495 3
496 1
497 2
498 5
499 1
500 4
501 6
502 4
503 1
504 1
505 4
506 4
507 1
508 4
509 2
510 3
511 2
513 6
514 2
515 2
516 6
517 7
518 2
519 3
520 1
521 6
522 2
523 5
524 1
525 2
526 2
527 2
528 1
529 3
530 2
531 2
532 1
533 4
534 8
535 1
536 2
537 4
538 2
539 2
540 1
541 1
542 1
543 1
544 2
545 3
546 1
547 2
548 4
549 2
550 1
552 2
553 3
554 3
555 3
556 5
557 4
558 2
559 4
561 3
562 4
563 1
564 4
567 3
569 2
570 2
571 1
572 3
573 1
574 6
575 3
576 2
577 2
578 2
579 1
580 4
581 4
582 3
583 1
584 3
585 3
586 1
587 2
588 2
589 2
590 1
591 3
592 1
593 2
594 6
595 4
596 6
597 3
598 2
599 2
601 5
603 2
604 5
605 2
606 2
607 3
608 2
609 5
610 1
611 2
612 2
613 4
616 1
617 2
618 1
619 1
620 2
621 2
622 1
623 1
624 3
625 5
626 1
627 2
628 4
630 1
631 2
632 2
633 4
635 4
636 3
637 2
638 2
639 4
640 3
641 1
642 2
644 1
645 4
646 4
647 2
648 1
649 2
650 2
651 2
652 3
653 2
654 4
655 1
656 2
657 1
658 2
659 3
660 1
661 5
662 1
663 3
664 3
665 1
666 2
667 1
668 1
671 1
672 2
673 1
674 1
675 1
677 2
678 2
679 3
680 1
682 4
684 2
685 1
686 1
687 1
688 2
689 1
690 1
691 1
694 4
695 2
696 2
697 1
699 2
700 2
702 1
703 1
704 1
705 1
706 1
707 1
712 1
713 3
714 1
715 1
716 2
717 1
718 1
719 2
720 2
721 3
722 2
723 1
724 2
725 1
729 1
730 1
731 1
732 3
733 2
735 1
736 2
737 1
738 1
739 1
741 1
744 3
746 2
747 1
748 1
749 1
750 1
751 1
752 1
753 2
754 1
755 1
756 1
760 1
761 1
763 3
764 1
765 1
766 1
767 1
768 2
770 3
771 4
772 1
774 1
775 1
777 1
778 1
779 1
780 2
782 1
784 2
789 1
790 1
792 2
793 4
794 1
797 1
800 1
802 2
803 1
804 1
806 2
807 1
808 3
809 2
810 3
811 3
813 1
814 1
815 1
816 1
817 1
818 2
819 1
820 1
821 1
822 1
823 1
824 3
828 1
829 2
832 1
835 3
836 1
837 2
838 1
840 1
844 1
847 2
849 1
850 1
852 1
854 3
858 1
859 2
861 1
862 1
863 3
864 1
866 1
867 2
869 2
871 1
872 1
873 2
876 4
878 2
880 1
882 2
885 2
886 1
887 1
889 1
890 1
891 1
892 1
895 2
897 1
898 2
899 1
902 2
903 1
905 2
907 2
909 2
910 1
911 1
912 1
917 1
918 1
921 1
922 2
923 2
927 2
928 1
930 1
932 1
937 1
939 1
940 1
944 1
945 1
947 1
951 2
952 1
953 2
956 2
959 1
961 1
963 1
964 2
965 2
967 1
970 1
971 1
981 2
982 2
984 2
985 1
986 1
989 1
990 1
992 1
993 2
994 1
995 1
996 1
997 1
998 1
1000    2
1002    1
1003    1
1004    2
1005    1
1012    1
1013    1
1017    1
1021    2
1022    1
1025    1
1027    1
1030    1
1031    2
1033    2
1034    1
1036    1
1037    1
1038    2
1040    1
1041    1
1046    1
1051    1
1053    1
1056    1
1058    1
1061    1
1062    1
1063    2
1065    1
1067    1
1069    2
1070    1
1072    1
1073    1
1074    1
1075    1
1077    1
1079    1
1082    1
1083    1
1084    2
1086    1
1093    1
1095    2
1096    1
1099    1
1101    1
1109    1
1110    1
1115    1
1122    1
1124    2
1125    1
1127    1
1130    1
1132    1
1139    2
1140    2
1142    1
1143    1
1149    1
1151    1
1153    2
1156    1
1158    1
1162    1
1163    1
1164    1
1167    2
1168    1
1170    1
1177    1
1180    1
1183    1
1185    1
1189    2
1200    1
1202    1
1203    1
1204    1
1206    1
1212    2
1215    1
1216    1
1217    2
1218    1
1219    1
1224    1
1225    1
1228    1
1231    1
1238    1
1243    1
1246    1
1249    1
1259    1
1264    1
1269    2
1274    1
1283    1
1284    1
1286    1
1288    1
1289    1
1295    1
1305    1
1313    1
1317    1
1319    1
1326    1
1328    1
1341    1
1345    1
1350    1
1351    1
1354    2
1359    1
1365    1
1371    1
1375    1
1386    1
1388    1
1394    1
1422    1
1426    1
1427    1
1433    1
1435    1
1438    1
1439    1
1445    1
1452    1
1456    2
1462    1
1465    1
1472    1
1476    1
1478    1
1485    1
1486    1
1487    1
1492    1
1493    1
1499    1
1516    1
1533    1
1535    1
1536    1
1549    1
1550    1
1556    1
1558    1
1569    1
1588    2
1609    1
1629    1
1630    1
1644    2
1649    1
1652    1
1660    1
1686    2
1689    1
1692    1
1703    1
1712    1
1713    1
1719    1
1727    1
1730    1
1738    1
1741    1
1757    1
1759    1
1762    1
1772    1
1792    1
1824    1
1831    1
1833    1
1847    1
1855    1
1870    1
1878    1
1880    1
1900    1
1920    1
1924    1
1927    1
1934    2
1941    1
1970    1
1977    1
1987    1
1991    1
1999    1
2013    1
2016    1
2034    1
2036    1
2046    1
2047    1
2050    1
2054    1
2072    1
2076    1
2103    1
2108    1
2152    1
2154    1
2173    1
2176    1
2184    1
2186    1
2188    1
2236    1
2273    1
2282    1
2296    1
2414    1
2417    1
2443    1
2489    1
2548    1
2558    1
2570    2
2586    1
2590    1
2676    1
2690    1
2697    2
2714    1
2732    1
2736    1
2859    1
2900    1
2906    1
2935    1
2941    1
2965    1
2969    1
3049    1
3104    1
3109    1
3177    1
3432    1
3478    1
3536    1
3644    1
3663    1
4052    1
4500    1
4782    1
5341    1
5798    1
5871    1
5948    1
6559    1
6926    1

[ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] ..__......................................................................................._........... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT] Command completed. Elapsed time: 0:02:57. Running peak memory: 4.061GB.
PID: 390092; Command: preseq; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt

echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt (390311)


Command completed. Elapsed time: 0:00:42. Running peak memory: 4.061GB.
PID: 390311; Command: echo; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot (390629)

Processing Jurkat_ChRO-seq_2
INFO: Found real counts for Jurkat_ChRO-seq_2 - Total (M): 33.989659 Unique (M): 30.4684

Library complexity plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 390629; Command: Rscript; Return code: 0; Memory used: 0.286GB

Library complexity QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf Library complexity QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png PEPPRO OBJ Missing stat 'Frac_exp_unique_at_10M'

grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt | awk '{print $2}'

Frac_exp_unique_at_10M 0.646 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 08:40:15) elapsed: 397.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv (390651)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmp_Jurkat_ChRO-seq_2_sort_2eb60nhd'
Processing with 12 cores...
Discarding 98 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1']
Keeping 97 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:39. Running peak memory: 4.061GB.
PID: 390651; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.617GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv

NRF 0.53 PEPPRO RES

PBC1 0.8 PEPPRO RES

PBC2 8.39 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam (390713)


Command completed. Elapsed time: 0:00:09. Running peak memory: 4.061GB.
PID: 390713; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam

Unmapped_reads 2435871 PEPPRO RES

Split BAM by strand (06-15 08:41:10) elapsed: 55.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam (390797)


Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB.
PID: 390797; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam (390917)


Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB.
PID: 390917; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 08:44:34) elapsed: 204.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (391064)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391064; Command: sed; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt (391065)


Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 391065; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.553GB

TSS_coding_score 68.4 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt (391102)


Command completed. Elapsed time: 0:00:10. Running peak memory: 4.061GB.
PID: 391102; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.548GB

TSS_non-coding_score 23.2 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt (391139)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 4.061GB.
PID: 391139; Command: Rscript; Return code: 0; Memory used: 0.316GB

TSS enrichment QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt (391385,391386,391387,391388)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391385; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 391387; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 391386; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 391388; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt (391390)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391390; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 08:45:03) elapsed: 29.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed (391393,391394)


Command completed. Elapsed time: 0:00:02. Running peak memory: 4.061GB.
PID: 391393; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 391394; Command: bedtools; Return code: 0; Memory used: 0.099GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed (391399,391400)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391399; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 391400; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed (391402,391403,391404,391405)


Command completed. Elapsed time: 0:00:46. Running peak memory: 4.061GB.
PID: 391405; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 391402; Command: bedtools; Return code: 0; Memory used: 0.029GB
PID: 391404; Command: sort; Return code: 0; Memory used: 0.012GB
PID: 391403; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed (391448,391449,391450)


Command completed. Elapsed time: 0:00:58. Running peak memory: 4.061GB.
PID: 391448; Command: bedtools; Return code: 0; Memory used: 0.099GB
PID: 391450; Command: sort; Return code: 0; Memory used: 0.009GB
PID: 391449; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v (391500,391501,391502)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391500; Command: join; Return code: 0; Memory used: 0.001GB
PID: 391502; Command: env; Return code: 0; Memory used: 0.004GB
PID: 391501; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0241981) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed (391509)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391509; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 85.85 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed (391514)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 391514; Command: Rscript; Return code: 0; Memory used: 0.318GB

Pause index QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf Pause index QC_hg38/Jurkat_ChRO-seq_2_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed (391535)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391535; Command: pigz; Return code: 0; Memory used: 0.004GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 08:46:55) elapsed: 112.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam 34004054 12298505

Plus_FRiP 0.36 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam 34004054 11929067

Minus_FRiP 0.35 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed (391688,391689)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391688; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 391689; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed (391691)


Command completed. Elapsed time: 0:00:59. Running peak memory: 4.061GB.
PID: 391691; Command: bedtools; Return code: 0; Memory used: 0.1GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz (391745)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391745; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed (391746)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391746; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 08:48:56) elapsed: 121.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed (391754)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391754; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed (391756,391757,391758,391759)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 391756; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 391757; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 391759; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 391758; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed (391762)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 391762; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed (391857)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 391857; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed (391890,391891,391892,391893)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 391890; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 391891; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 391893; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 391892; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed (391895)


Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB.
PID: 391895; Command: bedtools; Return code: 0; Memory used: 0.056GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed (391998)


Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB.
PID: 391998; Command: bedtools; Return code: 0; Memory used: 0.047GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region" (392261)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392261; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed (392262,392263,392264,392265)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392262; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392264; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392263; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392265; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed (392268)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392268; Command: bedtools; Return code: 0; Memory used: 0.011GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed (392304)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392304; Command: bedtools; Return code: 0; Memory used: 0.019GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR" (392339)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392339; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed (392340,392341,392342,392343)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392340; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392341; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392343; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 392342; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed (392345)


Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392345; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed (392379)


Command completed. Elapsed time: 0:00:21. Running peak memory: 4.061GB.
PID: 392379; Command: bedtools; Return code: 0; Memory used: 0.029GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR" (392415)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 392415; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed (392416,392417,392418,392419)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392416; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392417; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392419; Command: bedtools; Return code: 0; Memory used: 0.036GB
PID: 392418; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed (392422)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392422; Command: bedtools; Return code: 0; Memory used: 0.015GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed (392448)


Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB.
PID: 392448; Command: bedtools; Return code: 0; Memory used: 0.017GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed (392494,392495,392496,392497)


Command completed. Elapsed time: 0:00:03. Running peak memory: 4.061GB.
PID: 392494; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392495; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 392497; Command: bedtools; Return code: 0; Memory used: 0.173GB
PID: 392496; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed (392502)


Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB.
PID: 392502; Command: bedtools; Return code: 0; Memory used: 0.064GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed (392524)


Command completed. Elapsed time: 0:00:23. Running peak memory: 4.061GB.
PID: 392524; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed (392560,392561,392562,392563)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 392560; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 392562; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 392561; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 392563; Command: bedtools; Return code: 0; Memory used: 0.083GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed (392566)


Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392566; Command: bedtools; Return code: 0; Memory used: 0.068GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed (392597)


Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB.
PID: 392597; Command: bedtools; Return code: 0; Memory used: 0.072GB

Plot cFRiF/FRiF (06-15 08:54:07) elapsed: 311.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed (392635)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:36. Running peak memory: 4.061GB.
PID: 392635; Command: Rscript; Return code: 0; Memory used: 0.467GB

cFRiF QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf cFRiF QC_hg38/Jurkat_ChRO-seq_2_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed (392790)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB.
PID: 392790; Command: Rscript; Return code: 0; Memory used: 0.469GB

FRiF QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf FRiF QC_hg38/Jurkat_ChRO-seq_2_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 08:55:11) elapsed: 64.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed (393034,393035)


Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393035; Command: bedtools; Return code: 0; Memory used: 0.097GB
PID: 393034; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed (393080,393081,393082)


Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393080; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 393082; Command: bedtools; Return code: 0; Memory used: 0.003GB
PID: 393081; Command: bedtools; Return code: 0; Memory used: 0.037GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed (393089)


Command completed. Elapsed time: 0:00:38. Running peak memory: 4.061GB.
PID: 393089; Command: bedtools; Return code: 0; Memory used: 0.032GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed (393166)


Command completed. Elapsed time: 0:00:43. Running peak memory: 4.061GB.
PID: 393166; Command: bedtools; Return code: 0; Memory used: 0.059GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed (393768,393769,393770)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 393768; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 393770; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 393769; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed (393773,393774,393775)


Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB.
PID: 393773; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 393775; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 393774; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed (393777,393778,393779)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 393777; Command: join; Return code: 0; Memory used: 0.001GB
PID: 393779; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 393778; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.2 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed --annotate (393786)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB.
PID: 393786; Command: Rscript; Return code: 0; Memory used: 0.316GB

mRNA contamination QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf mRNA contamination QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed (393816)


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB.
PID: 393816; Command: pigz; Return code: 0; Memory used: 0.005GB

Produce bigWig files (06-15 08:56:48) elapsed: 98.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam (393824)


Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 393824; Command: samtools; Return code: 0; Memory used: 0.007GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0 (393843)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_plus_cuttrace_ywx6rsj8'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 114 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2']
Keeping 81 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270591v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw'
Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:41. Running peak memory: 4.061GB.
PID: 393843; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.705GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam (396260)


Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB.
PID: 396260; Command: samtools; Return code: 0; Memory used: 0.007GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0 (396271)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam'
Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_minus_cuttrace_43w60_dz'
Processing with 4 cores...
stdin is empty of data
Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270719v1_random', 'chr14_KI270722v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1']
Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_GL000194v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw'
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:35. Running peak memory: 4.061GB.
PID: 396271; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.618GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 1:55:16
  • Total elapsed time (all runs): 2:23:22
  • Peak memory (this run): 4.0615 GB
  • Pipeline completed time: 2020-06-15 09:12:28