Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_GRO-seq --genome hg38 --input /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol GRO --umi-len 0 --scale --prealignments human_rDNA --dirty
  • Compute host: udc-aj38-17c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/
  • Pipeline started at: (06-11 17:29:51) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR1552484.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: GRO
  • recover: False
  • sample_name: K562_GRO-seq
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Local input file: /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz

File_mb 1322.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected GRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz

ln -sf /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz (347126)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 347126; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1.fastq (347127)


Command completed. Elapsed time: 0:01:06. Running peak memory: 0.002GB.
PID: 347127; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 30363736 PEPPRO RES

Fastq_reads 30363736 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz']

FASTQ processing: (06-11 17:31:22) elapsed: 89.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_processed.fastq

(cutadapt -j 12 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt (347505)


Command completed. Elapsed time: 0:00:42. Running peak memory: 2.13GB.
PID: 347505; Command: cutadapt; Return code: 0; Memory used: 2.13GB

seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_noadap.fastq | seqtk seq -L 2 - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_processed.fastq (347576,347578)


Command completed. Elapsed time: 0:01:00. Running peak memory: 2.13GB.
PID: 347576; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 347578; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 22296806.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 1041369.0 PEPPRO RES

Pct_uninformative_adapter_reads 3.4296 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastqc/K562_GRO-seq_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (347706)

Calculate the number of trimmed reads

Command completed. Elapsed time: 0:00:00. Running peak memory: 2.13GB.
PID: 347706; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 29322367 PEPPRO RES

Trim_loss_rate 3.43 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_processed.fastq (347737)

Started analysis of K562_GRO-seq_R1_processed.fastq
Approx 5% complete for K562_GRO-seq_R1_processed.fastq
Approx 10% complete for K562_GRO-seq_R1_processed.fastq
Approx 15% complete for K562_GRO-seq_R1_processed.fastq
Approx 20% complete for K562_GRO-seq_R1_processed.fastq
Approx 25% complete for K562_GRO-seq_R1_processed.fastq
Approx 30% complete for K562_GRO-seq_R1_processed.fastq
Approx 35% complete for K562_GRO-seq_R1_processed.fastq
Approx 40% complete for K562_GRO-seq_R1_processed.fastq
Approx 45% complete for K562_GRO-seq_R1_processed.fastq
Approx 50% complete for K562_GRO-seq_R1_processed.fastq
Approx 55% complete for K562_GRO-seq_R1_processed.fastq
Approx 60% complete for K562_GRO-seq_R1_processed.fastq
Approx 65% complete for K562_GRO-seq_R1_processed.fastq
Approx 70% complete for K562_GRO-seq_R1_processed.fastq
Approx 75% complete for K562_GRO-seq_R1_processed.fastq
Approx 80% complete for K562_GRO-seq_R1_processed.fastq
Approx 85% complete for K562_GRO-seq_R1_processed.fastq
Approx 90% complete for K562_GRO-seq_R1_processed.fastq
Approx 95% complete for K562_GRO-seq_R1_processed.fastq
Analysis complete for K562_GRO-seq_R1_processed.fastq
Command completed. Elapsed time: 0:01:29. Running peak memory: 2.13GB.
PID: 347737; Command: fastqc; Return code: 0; Memory used: 0.165GB

FastQC report r1 fastqc/K562_GRO-seq_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/processed_R1.flag (348047)


Command completed. Elapsed time: 0:00:00. Running peak memory: 2.13GB.
PID: 348047; Command: touch; Return code: 0; Memory used: 0.0GB

Plot adapter insertion distribution (06-11 17:35:38) elapsed: 256.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt (348048)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:11. Running peak memory: 2.13GB.
PID: 348048; Command: Rscript; Return code: 0; Memory used: 0.112GB

Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 22 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-11 17:35:49) elapsed: 11.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.7189 PEPPRO RES

Prealignments (06-11 17:35:49) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 17:35:49) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_GRO-seq -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 29322367 reads; of these: 29322367 (100.00%) were unpaired; of these: 25012896 (85.30%) aligned 0 times 4309471 (14.70%) aligned exactly 1 time 0 (0.00%) aligned >1 times 14.70% overall alignment rate

Aligned_reads_human_rDNA 4309471.0 PEPPRO RES

Alignment_rate_human_rDNA 14.7 PEPPRO RES

Map to genome (06-11 17:39:22) elapsed: 213.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id K562_GRO-seq -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/tmpuee4zdhj -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam (348363,348364,348365)

25012896 reads; of these:
  25012896 (100.00%) were unpaired; of these:
    2113226 (8.45%) aligned 0 times
    15215880 (60.83%) aligned exactly 1 time
    7683790 (30.72%) aligned >1 times
91.55% overall alignment rate
[bam_sort_core] merging from 6 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:10:14. Running peak memory: 3.668GB.
PID: 348363; Command: bowtie2; Return code: 0; Memory used: 3.668GB
PID: 348364; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 348365; Command: samtools; Return code: 0; Memory used: 0.902GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam (349569)


Command completed. Elapsed time: 0:00:54. Running peak memory: 3.668GB.
PID: 349569; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 22899670 PEPPRO RES

QC_filtered_reads 4468262 PEPPRO RES

Aligned_reads 18431408 PEPPRO RES

Alignment_rate 62.86 PEPPRO RES

Total_efficiency 60.7 PEPPRO RES

Read_depth 2.65 PEPPRO RES

Compress all unmapped read files (06-11 18:00:14) elapsed: 1252.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq (351183)


Command completed. Elapsed time: 0:00:47. Running peak memory: 3.668GB.
PID: 351183; Command: pigz; Return code: 0; Memory used: 0.013GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam (351262)


Command completed. Elapsed time: 0:00:18. Running peak memory: 3.668GB.
PID: 351262; Command: samtools; Return code: 0; Memory used: 0.017GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 843399 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam (351285)


Command completed. Elapsed time: 0:00:14. Running peak memory: 3.668GB.
PID: 351285; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/chr_sizes.bed (351301,351302,351303,351304)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351301; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 351303; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 351302; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 351304; Command: grep; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_noMT.bam (351307)


Command completed. Elapsed time: 0:00:32. Running peak memory: 3.668GB.
PID: 351307; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam (351355)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351355; Command: mv; Return code: 0; Memory used: 0.001GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam (351356)


Command completed. Elapsed time: 0:00:16. Running peak memory: 3.668GB.
PID: 351356; Command: samtools; Return code: 0; Memory used: 0.014GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 50 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-11 18:03:14) elapsed: 180.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv (351434)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmp_K562_GRO-seq_sort_gbhq8men'
Processing with 12 cores...
Discarding 91 chunk(s) of reads: ['chrM', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1']
Keeping 104 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_KI270374v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:00:34. Running peak memory: 3.668GB.
PID: 351434; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.057GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv

NRF 0.7 PEPPRO RES

PBC1 0.86 PEPPRO RES

PBC2 8.69 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_unmap.bam (351500)


Command completed. Elapsed time: 0:00:06. Running peak memory: 3.668GB.
PID: 351500; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_temp.bam

Unmapped_reads 2113226 PEPPRO RES

Split BAM by strand (06-11 18:03:58) elapsed: 44.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam (351538)


Command completed. Elapsed time: 0:01:06. Running peak memory: 3.668GB.
PID: 351538; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam (351800)


Command completed. Elapsed time: 0:01:03. Running peak memory: 3.668GB.
PID: 351800; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-11 18:06:07) elapsed: 129.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (351866)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351866; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_plus_TssEnrichment.txt (351867)


Command completed. Elapsed time: 0:00:06. Running peak memory: 3.668GB.
PID: 351867; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.599GB

TSS_coding_score 23.9 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_minus_TssEnrichment.txt (351903)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.668GB.
PID: 351903; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.746GB

TSS_non-coding_score 8.6 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_minus_TssEnrichment.txt (351934)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:12. Running peak memory: 3.668GB.
PID: 351934; Command: Rscript; Return code: 0; Memory used: 0.102GB

TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.pdf TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt (351961,351962,351963,351964)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351961; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 351963; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 351962; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 351964; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt (351967)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351967; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-11 18:06:32) elapsed: 25.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_tss.bed (351969,351970)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.668GB.
PID: 351969; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 351970; Command: bedtools; Return code: 0; Memory used: 0.094GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_gene_body.bed (351974,351975)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.668GB.
PID: 351974; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 351975; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed (351979,351980,351981,351982)


Command completed. Elapsed time: 0:00:26. Running peak memory: 3.668GB.
PID: 351979; Command: bedtools; Return code: 0; Memory used: 0.014GB
PID: 351981; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 351980; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 351982; Command: sort; Return code: 0; Memory used: 0.003GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed (352009,352010,352012)


Command completed. Elapsed time: 0:00:38. Running peak memory: 3.668GB.
PID: 352012; Command: sort; Return code: 0; Memory used: 0.007GB
PID: 352009; Command: bedtools; Return code: 0; Memory used: 0.051GB
PID: 352010; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed
awk: cmd. line:1: { if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}} awk: cmd. line:1: ^ syntax error awk: cmd. line:1: { if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}} awk: cmd. line:1: ^ syntax error

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == ){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmpxwvopkcb (352054,352055,352056)


Got SIGTERM. Failing gracefully... (06-11 18:55:15) elapsed: 2923.0 TIME
Child process 352054 (join) terminated after 0 sec.
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/recover.lock.QC_hg38__K562_GRO-seq_pause_index.bed

Pipeline failed at: (06-11 18:55:15) elapsed: 0.0 TIME

Total time: 1:25:24 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_GRO-seq --genome hg38 --input /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol GRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba26-16
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/
  • Pipeline started at: (06-11 19:10:15) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR1552484.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: GRO
  • recover: True
  • sample_name: K562_GRO-seq
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/PEPPRO_failed.flag' Local input file: /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz

File_mb 1322.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected GRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz']

FASTQ processing: (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/processed_R1.flag

Plot adapter insertion distribution (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-11 19:10:15) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 19:10:15) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq

Map to genome (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam

Compress all unmapped read files (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_unmap.bam

Split BAM by strand (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam

Calculate TSS enrichment (06-11 19:10:15) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSSenrichment.pdf

TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.pdf TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-11 19:10:15) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed
Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/lock.QC_hg38__K562_GRO-seq_pause_index.bed Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmpnu6wpr_c (71328,71329,71330)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.006GB.
PID: 71328; Command: join; Return code: 0; Memory used: 0.001GB
PID: 71330; Command: env; Return code: 0; Memory used: 0.006GB
PID: 71329; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmpnu6wpr_c | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]} /bin/sh: -c: line 0: unexpected EOF while looking for matching `'' /bin/sh: -c: line 1: syntax error: unexpected end of file

Pipeline failed at: (06-11 19:10:16) elapsed: 0.0 TIME

Total time: 0:00:01 Failure reason: Command 'awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmpnu6wpr_c | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' returned non-zero exit status 1.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_GRO-seq --genome hg38 --input /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol GRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aj37-18c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/
  • Pipeline started at: (06-14 21:14:10) elapsed: 9.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR1552484.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: GRO
  • recover: True
  • sample_name: K562_GRO-seq
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/PEPPRO_failed.flag' Local input file: /project/shefflab/data//sra_fastq/SRR1552484.fastq.gz

File_mb 1322.25 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected GRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/K562_GRO-seq_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/K562_GRO-seq.fastq.gz']

FASTQ processing: (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/fastq/processed_R1.flag

Plot adapter insertion distribution (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_GRO-seq_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-14 21:14:11) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-14 21:14:11) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq

Map to genome (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam

Compress all unmapped read files (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/prealignments/K562_GRO-seq_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_unmap.bam

Split BAM by strand (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam

Calculate TSS enrichment (06-14 21:14:11) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSSenrichment.pdf

TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.pdf TSS enrichment QC_hg38/K562_GRO-seq_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-14 21:14:11) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmp4yy_drxc (428183,428191,428201)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 428183; Command: join; Return code: 0; Memory used: 0.001GB
PID: 428201; Command: env; Return code: 0; Memory used: 0.004GB
PID: 428191; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmp4yy_drxc | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0172824) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/tmp4yy_drxc > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed (428280)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 428280; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 10.74 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed (428320)

Pause index plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.287GB.
PID: 428320; Command: Rscript; Return code: 0; Memory used: 0.287GB

Pause index QC_hg38/K562_GRO-seq_pause_index.pdf Pause index QC_hg38/K562_GRO-seq_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_pause_index.bed (429780)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 429780; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-14 21:14:18) elapsed: 6.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam 18431408 6290701

Plus_FRiP 0.34 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam 18431408 5983864

Minus_FRiP 0.32 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_gene_sort.bed (430842,430843)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 430842; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 430843; Command: bedtools; Return code: 0; Memory used: 0.005GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_gene_coverage.bed (430845)


Command completed. Elapsed time: 0:00:27. Running peak memory: 0.287GB.
PID: 430845; Command: bedtools; Return code: 0; Memory used: 0.074GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed.gz (431095)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431095; Command: ln; Return code: 0; Memory used: 0.0GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed (431096)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431096; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-14 21:15:17) elapsed: 60.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/raw/hg38_annotations.bed (431105)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 431105; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer_sort.bed (431108,431109,431111,431113)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 431108; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 431109; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 431113; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 431111; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_plus_coverage.bed (431115)


Command completed. Elapsed time: 0:00:11. Running peak memory: 0.287GB.
PID: 431115; Command: bedtools; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_minus_coverage.bed (431133)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431133; Command: bedtools; Return code: 0; Memory used: 0.008GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_sort.bed (431145,431146,431147,431148)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431145; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 431146; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 431148; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 431147; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_plus_coverage.bed (431150)


Command completed. Elapsed time: 0:00:11. Running peak memory: 0.287GB.
PID: 431150; Command: bedtools; Return code: 0; Memory used: 0.025GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_minus_coverage.bed (431171)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431171; Command: bedtools; Return code: 0; Memory used: 0.027GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region" (431197)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431197; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed (431198,431199,431200,431201)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 431198; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 431200; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 431199; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 431201; Command: bedtools; Return code: 0; Memory used: 0.009GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_plus_coverage.bed (431204)


Command completed. Elapsed time: 0:00:11. Running peak memory: 0.287GB.
PID: 431204; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_minus_coverage.bed (431228)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431228; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR" (431248)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431248; Command: mv; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR_sort.bed (431249,431250,431251,431252)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 431249; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 431250; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 431252; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 431251; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_plus_coverage.bed (431255)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431255; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_minus_coverage.bed (431268)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431268; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR" (431285)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.287GB.
PID: 431285; Command: mv; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR_sort.bed (431286,431287,431288,431289)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 431286; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 431287; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 431289; Command: bedtools; Return code: 0; Memory used: 0.035GB
PID: 431288; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_plus_coverage.bed (431291)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431291; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_minus_coverage.bed (431349)


Command completed. Elapsed time: 0:00:10. Running peak memory: 0.287GB.
PID: 431349; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon_sort.bed (436564,436572,436585,436590)


Command completed. Elapsed time: 0:00:03. Running peak memory: 0.287GB.
PID: 436564; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 436572; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 436590; Command: bedtools; Return code: 0; Memory used: 0.172GB
PID: 436585; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_plus_coverage.bed (439659)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.287GB.
PID: 439659; Command: bedtools; Return code: 0; Memory used: 0.018GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_minus_coverage.bed (456903)


Command completed. Elapsed time: 0:00:12. Running peak memory: 0.287GB.
PID: 456903; Command: bedtools; Return code: 0; Memory used: 0.021GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron_sort.bed (14009,14016,14019,14023)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.287GB.
PID: 14009; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 14019; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 14016; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 14023; Command: bedtools; Return code: 0; Memory used: 0.078GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_plus_coverage.bed (15300)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.287GB.
PID: 15300; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_minus_coverage.bed (17150)


Command completed. Elapsed time: 0:00:13. Running peak memory: 0.287GB.
PID: 17150; Command: bedtools; Return code: 0; Memory used: 0.028GB

Plot cFRiF/FRiF (06-14 21:18:00) elapsed: 163.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_GRO-seq -z 3099922541 -n 9058650 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_plus_coverage.bed (21478)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:35. Running peak memory: 0.462GB.
PID: 21478; Command: Rscript; Return code: 0; Memory used: 0.462GB

cFRiF QC_hg38/K562_GRO-seq_cFRiF.pdf cFRiF QC_hg38/K562_GRO-seq_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_GRO-seq -z 3099922541 -n 9058650 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_Intron_plus_coverage.bed (53701)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:25. Running peak memory: 0.507GB.
PID: 53701; Command: Rscript; Return code: 0; Memory used: 0.507GB

FRiF QC_hg38/K562_GRO-seq_FRiF.pdf FRiF QC_hg38/K562_GRO-seq_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-14 21:19:00) elapsed: 61.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_exons_sort.bed (61345,61346)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.507GB.
PID: 61345; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 61346; Command: bedtools; Return code: 0; Memory used: 0.099GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_introns_sort.bed (61352,61353,61354)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.507GB.
PID: 61352; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 61354; Command: bedtools; Return code: 0; Memory used: 0.006GB
PID: 61353; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_coverage.bed (61366)


Command completed. Elapsed time: 0:00:20. Running peak memory: 0.507GB.
PID: 61366; Command: bedtools; Return code: 0; Memory used: 0.047GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_coverage.bed (61487)


Command completed. Elapsed time: 0:00:23. Running peak memory: 0.507GB.
PID: 61487; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.431408)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_rpkm.bed (61511,61512,61513)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.507GB.
PID: 61511; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 61513; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 61512; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/18.431408)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_rpkm.bed (61516,61517,61518)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.507GB.
PID: 61516; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 61518; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 61517; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed (61521,61522,61523)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.507GB.
PID: 61521; Command: join; Return code: 0; Memory used: 0.001GB
PID: 61523; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 61522; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.33 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed --annotate (61529)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:04. Running peak memory: 0.507GB.
PID: 61529; Command: Rscript; Return code: 0; Memory used: 0.323GB

mRNA contamination QC_hg38/K562_GRO-seq_mRNA_contamination.pdf mRNA contamination QC_hg38/K562_GRO-seq_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/QC_hg38/K562_GRO-seq_exon_intron_ratios.bed (61559)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.507GB.
PID: 61559; Command: pigz; Return code: 0; Memory used: 0.005GB

Produce bigWig files (06-14 21:19:59) elapsed: 58.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam (61567)


Command completed. Elapsed time: 0:00:06. Running peak memory: 0.507GB.
PID: 61567; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_smooth_body_0-mer.bw -p 8 --variable-step --scale 18431408.0 (61790)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_plus.bam'
Temporary files will be stored in: 'tmp_K562_GRO-seq_plus_cuttrace_pp7ztq7s'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
Discarding 100 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr14_KI270723v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1']
Keeping 95 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270580v1', 'chrUn_KI270579v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_KI270374v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 95 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_exact_body_0-mer.bw'
Merging 95 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:24. Running peak memory: 2.62GB.
PID: 61790; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.62GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam (239914)


Command completed. Elapsed time: 0:00:06. Running peak memory: 2.62GB.
PID: 239914; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_smooth_body_0-mer.bw -p 8 --variable-step --scale 18431408.0 (239935)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/aligned_hg38/K562_GRO-seq_minus.bam'
Temporary files will be stored in: 'tmp_K562_GRO-seq_minus_cuttrace_1axk6ebz'
Processing with 4 cores...
stdin is empty of data
Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270710v1_random', 'chr1_KI270712v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr11_KI270721v1_random', 'chr17_KI270730v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1']
Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270583v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_exact_body_0-mer.bw'
Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_GRO-seq/signal_hg38/K562_GRO-seq_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:16. Running peak memory: 2.732GB.
PID: 239935; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.732GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 0:20:51
  • Total elapsed time (all runs): 0:58:31
  • Peak memory (this run): 2.7315 GB
  • Pipeline completed time: 2020-06-14 21:34:52