Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_PRO-seq_100 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR1554311.fastq.gz /project/shefflab/data//sra_fastq/SRR1554312.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 32 -M 32000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aj40-15c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/
  • Pipeline started at: (06-11 19:07:43) elapsed: 3.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 32
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR1554311.fastq.gz', '/project/shefflab/data//sra_fastq/SRR1554312.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 32000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_PRO-seq_100
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Local input file: /project/shefflab/data//sra_fastq/SRR1554311.fastq.gz

File_mb 38578.5 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz

cat /project/shefflab/data//sra_fastq/SRR1554311.fastq.gz /project/shefflab/data//sra_fastq/SRR1554312.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz (239583)


Command completed. Elapsed time: 0:02:48. Running peak memory: 0.003GB.
PID: 239583; Command: cat; Return code: 0; Memory used: 0.003GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1.fastq

pigz -f -p 32 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1.fastq (240015)


Command completed. Elapsed time: 0:14:07. Running peak memory: 0.003GB.
PID: 240015; Command: pigz; Return code: 0; Memory used: 0.003GB

Raw_reads 496581677 PEPPRO RES

Fastq_reads 496581677 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz']

FASTQ processing: (06-11 19:36:58) elapsed: 1755.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_processed.fastq

(cutadapt -j 32 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt (243484)


Command completed. Elapsed time: 0:14:01. Running peak memory: 11.493GB.
PID: 243484; Command: cutadapt; Return code: 0; Memory used: 11.493GB

seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_noadap.fastq | seqtk seq -L 2 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_processed.fastq (245187,245188)


Command completed. Elapsed time: 0:09:01. Running peak memory: 11.493GB.
PID: 245187; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 245188; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 423059183.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 12437983.0 PEPPRO RES

Pct_uninformative_adapter_reads 2.5047 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastqc/K562_PRO-seq_100_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (247019)

Calculate the number of trimmed reads

Command completed. Elapsed time: 0:00:00. Running peak memory: 11.493GB.
PID: 247019; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 484143694 PEPPRO RES

Trim_loss_rate 2.5 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_processed.fastq (247474)

Started analysis of K562_PRO-seq_100_R1_processed.fastq
Approx 5% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 10% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 15% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 20% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 25% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 30% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 35% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 40% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 45% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 50% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 55% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 60% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 65% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 70% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 75% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 80% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 85% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 90% complete for K562_PRO-seq_100_R1_processed.fastq
Approx 95% complete for K562_PRO-seq_100_R1_processed.fastq
Analysis complete for K562_PRO-seq_100_R1_processed.fastq
Command completed. Elapsed time: 0:26:15. Running peak memory: 11.493GB.
PID: 247474; Command: fastqc; Return code: 0; Memory used: 0.3GB

FastQC report r1 fastqc/K562_PRO-seq_100_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/processed_R1.flag (250743)


Command completed. Elapsed time: 0:00:00. Running peak memory: 11.493GB.
PID: 250743; Command: touch; Return code: 0; Memory used: 0.002GB

Plot adapter insertion distribution (06-11 20:34:31) elapsed: 3452.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt (250749)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 11.493GB.
PID: 250749; Command: Rscript; Return code: 0; Memory used: 0.204GB

Adapter insertion distribution cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 34 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-11 20:34:37) elapsed: 6.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.2312 PEPPRO RES

Prealignments (06-11 20:34:37) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 20:34:37) elapsed: 0.0 TIME

(bowtie2 -p 32 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_PRO-seq_100 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 484143694 reads; of these: 484143694 (100.00%) were unpaired; of these: 439463330 (90.77%) aligned 0 times 44680364 (9.23%) aligned exactly 1 time 0 (0.00%) aligned >1 times 9.23% overall alignment rate

Aligned_reads_human_rDNA 44680364.0 PEPPRO RES

Alignment_rate_human_rDNA 9.23 PEPPRO RES

Map to genome (06-11 21:34:48) elapsed: 3611.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam

bowtie2 -p 32 --very-sensitive --rg-id K562_PRO-seq_100 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/tmplun3n5k_ -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam (258021,258027,258028)

439463330 reads; of these:
  439463330 (100.00%) were unpaired; of these:
    5393540 (1.23%) aligned 0 times
    328159166 (74.67%) aligned exactly 1 time
    105910624 (24.10%) aligned >1 times
98.77% overall alignment rate
[bam_sort_core] merging from 142 files and 1 in-memory blocks...
Command completed. Elapsed time: 3:21:41. Running peak memory: 11.493GB.
PID: 258021; Command: bowtie2; Return code: 0; Memory used: 4.227GB
PID: 258027; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 258028; Command: samtools; Return code: 0; Memory used: 0.906GB

samtools view -q 10 -b -@ 32 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam (279311)


Command completed. Elapsed time: 0:08:44. Running peak memory: 11.493GB.
PID: 279311; Command: samtools; Return code: 0; Memory used: 0.036GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 434069790 PEPPRO RES

QC_filtered_reads 46741044 PEPPRO RES

Aligned_reads 387328746 PEPPRO RES

Alignment_rate 80.0 PEPPRO RES

Total_efficiency 78.0 PEPPRO RES

Read_depth 29.61 PEPPRO RES

Compress all unmapped read files (06-12 02:01:41) elapsed: 16013.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq.gz

pigz -f -p 32 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq (286219)


Command completed. Elapsed time: 0:06:42. Running peak memory: 11.493GB.
PID: 286219; Command: pigz; Return code: 0; Memory used: 0.024GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam (286889)


Command completed. Elapsed time: 0:06:33. Running peak memory: 11.493GB.
PID: 286889; Command: samtools; Return code: 0; Memory used: 0.027GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 9149071 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam (287540)


Command completed. Elapsed time: 0:05:38. Running peak memory: 11.493GB.
PID: 287540; Command: samtools; Return code: 0; Memory used: 0.024GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/chr_sizes.bed (288310,288311,288312,288313)


Command completed. Elapsed time: 0:00:00. Running peak memory: 11.493GB.
PID: 288312; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 288310; Command: samtools; Return code: 0; Memory used: 0.01GB
PID: 288313; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 288311; Command: cut; Return code: 0; Memory used: 0.001GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/chr_sizes.bed -b -@ 32 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_noMT.bam (288315)


Command completed. Elapsed time: 0:04:16. Running peak memory: 11.493GB.
PID: 288315; Command: samtools; Return code: 0; Memory used: 0.037GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam (288608)


Command completed. Elapsed time: 0:00:03. Running peak memory: 11.493GB.
PID: 288608; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam (288612)


Command completed. Elapsed time: 0:05:31. Running peak memory: 11.493GB.
PID: 288612; Command: samtools; Return code: 0; Memory used: 0.024GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 100 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-12 02:47:15) elapsed: 2733.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -c 32 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv (291051)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmp_K562_PRO-seq_100_sort_440xxpb4'
Processing with 32 cores...
Discarding 81 chunk(s) of reads: ['chrM', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1']
Keeping 114 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270310v1', 'chrUn_KI270411v1', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:04:01. Running peak memory: 16.596GB.
PID: 291051; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 16.596GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv

NRF 0.28 PEPPRO RES

PBC1 0.54 PEPPRO RES

PBC2 3.89 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_unmap.bam

samtools view -b -@ 32 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_unmap.bam (291601)


Command completed. Elapsed time: 0:01:11. Running peak memory: 16.596GB.
PID: 291601; Command: samtools; Return code: 0; Memory used: 0.017GB

samtools view -c -f 4 -@ 32 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_temp.bam

Unmapped_reads 5393540 PEPPRO RES

Split BAM by strand (06-12 02:53:38) elapsed: 383.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam (291818)


Command completed. Elapsed time: 0:27:15. Running peak memory: 16.596GB.
PID: 291818; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam (294786)


Command completed. Elapsed time: 0:25:39. Running peak memory: 16.596GB.
PID: 294786; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-12 03:46:32) elapsed: 3174.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (297442)


Command completed. Elapsed time: 0:00:00. Running peak memory: 16.596GB.
PID: 297442; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/plus_TSS.tsv -p ends -c 32 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_plus_TssEnrichment.txt (297448)


Command completed. Elapsed time: 0:00:36. Running peak memory: 16.596GB.
PID: 297448; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 1.744GB

TSS_coding_score 13.9 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/minus_TSS.tsv -p ends -c 32 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_minus_TssEnrichment.txt (297553)


Command completed. Elapsed time: 0:00:27. Running peak memory: 16.596GB.
PID: 297553; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 2.008GB

TSS_non-coding_score 5.8 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_minus_TssEnrichment.txt (297652)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:07. Running peak memory: 16.596GB.
PID: 297652; Command: Rscript; Return code: 0; Memory used: 0.204GB

TSS enrichment QC_hg38/K562_PRO-seq_100_TSSenrichment.pdf TSS enrichment QC_hg38/K562_PRO-seq_100_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt (297684,297685,297686,297687)


Command completed. Elapsed time: 0:00:00. Running peak memory: 16.596GB.
PID: 297684; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 297686; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 297685; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 297687; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt (297689)


Command completed. Elapsed time: 0:00:00. Running peak memory: 16.596GB.
PID: 297689; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-12 03:47:43) elapsed: 71.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_tss.bed (297691,297692)


Command completed. Elapsed time: 0:00:02. Running peak memory: 16.596GB.
PID: 297691; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 297692; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_gene_body.bed (297696,297697)


Command completed. Elapsed time: 0:00:00. Running peak memory: 16.596GB.
PID: 297696; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 297697; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSS_density.bed (297699,297700,297701,297702)


Command completed. Elapsed time: 0:08:08. Running peak memory: 16.596GB.
PID: 297699; Command: bedtools; Return code: 0; Memory used: 0.103GB
PID: 297701; Command: sort; Return code: 0; Memory used: 0.01GB
PID: 297700; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 297702; Command: sort; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_gene_body_density.bed (298620,298626,298627)


Command completed. Elapsed time: 0:14:05. Running peak memory: 16.596GB.
PID: 298626; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 298620; Command: bedtools; Return code: 0; Memory used: 1.022GB
PID: 298627; Command: sort; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpuv374kz8 (299969,299975,299976)


Command completed. Elapsed time: 0:00:01. Running peak memory: 16.596GB.
PID: 299969; Command: join; Return code: 0; Memory used: 0.001GB
PID: 299976; Command: env; Return code: 0; Memory used: 0.006GB
PID: 299975; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpuv374kz8 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]} /bin/sh: -c: line 0: unexpected EOF while looking for matching `'' /bin/sh: -c: line 1: syntax error: unexpected end of file

Pipeline failed at: (06-12 04:09:58) elapsed: 1335.0 TIME

Total time: 9:02:18 Failure reason: Command 'awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpuv374kz8 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' returned non-zero exit status 1.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_PRO-seq_100 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR1554311.fastq.gz /project/shefflab/data//sra_fastq/SRR1554312.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 32 -M 32000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aj37-17c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/
  • Pipeline started at: (06-14 21:10:54) elapsed: 6.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 32
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//sra_fastq/SRR1554311.fastq.gz', '/project/shefflab/data//sra_fastq/SRR1554312.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 32000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_PRO-seq_100
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/PEPPRO_failed.flag' Local input file: /project/shefflab/data//sra_fastq/SRR1554311.fastq.gz

File_mb 38578.5 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/K562_PRO-seq_100_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/K562_PRO-seq_100.merged.fastq.gz']

FASTQ processing: (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/fastq/processed_R1.flag

Plot adapter insertion distribution (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_PRO-seq_100_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-14 21:10:55) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-14 21:10:55) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq

Map to genome (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam

Compress all unmapped read files (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/prealignments/K562_PRO-seq_100_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_unmap.bam

Split BAM by strand (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam

Calculate TSS enrichment (06-14 21:10:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSSenrichment.pdf

TSS enrichment QC_hg38/K562_PRO-seq_100_TSSenrichment.pdf TSS enrichment QC_hg38/K562_PRO-seq_100_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-14 21:10:55) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_gene_body_density.bed
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpot1hg31_ (280310,280311,280312)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.006GB.
PID: 280310; Command: join; Return code: 0; Memory used: 0.001GB
PID: 280312; Command: env; Return code: 0; Memory used: 0.006GB
PID: 280311; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpot1hg31_ | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.208447) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/tmpot1hg31_ > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed (280320)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.006GB.
PID: 280320; Command: awk; Return code: 0; Memory used: 0.004GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 10.96 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed (280325)

Pause index plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.212GB.
PID: 280325; Command: Rscript; Return code: 0; Memory used: 0.212GB

Pause index QC_hg38/K562_PRO-seq_100_pause_index.pdf Pause index QC_hg38/K562_PRO-seq_100_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed.gz

pigz -f -p 32 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_pause_index.bed (280358)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.212GB.
PID: 280358; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-14 21:11:01) elapsed: 6.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam 387328746 138157932

Plus_FRiP 0.36 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam 387328746 131399421

Minus_FRiP 0.34 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_gene_sort.bed (331289,331339)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.212GB.
PID: 331289; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 331339; Command: bedtools; Return code: 0; Memory used: 0.004GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_gene_coverage.bed (331715)


Command completed. Elapsed time: 0:15:16. Running peak memory: 1.021GB.
PID: 331715; Command: bedtools; Return code: 0; Memory used: 1.021GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed.gz (393358)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 393358; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 32 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed (393364)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 393364; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-14 21:37:32) elapsed: 1590.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/raw/hg38_annotations.bed (393373)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 393373; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer_sort.bed (393375,393376,393377,393378)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 393375; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 393376; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 393378; Command: bedtools; Return code: 0; Memory used: 0.048GB
PID: 393377; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_plus_coverage.bed (393381)


Command completed. Elapsed time: 0:04:20. Running peak memory: 1.021GB.
PID: 393381; Command: bedtools; Return code: 0; Memory used: 0.037GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_minus_coverage.bed (393904)


Command completed. Elapsed time: 0:04:08. Running peak memory: 1.021GB.
PID: 393904; Command: bedtools; Return code: 0; Memory used: 0.068GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_sort.bed (394351,394352,394353,394354)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 394351; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 394352; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 394354; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 394353; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_plus_coverage.bed (394356)


Command completed. Elapsed time: 0:05:01. Running peak memory: 1.021GB.
PID: 394356; Command: bedtools; Return code: 0; Memory used: 0.592GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_minus_coverage.bed (394913)


Command completed. Elapsed time: 0:04:57. Running peak memory: 1.021GB.
PID: 394913; Command: bedtools; Return code: 0; Memory used: 0.475GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region" (395414)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 395414; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region_sort.bed (395415,395416,395417,395418)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 395415; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 395417; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 395416; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 395418; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_plus_coverage.bed (395421)


Command completed. Elapsed time: 0:04:34. Running peak memory: 1.021GB.
PID: 395421; Command: bedtools; Return code: 0; Memory used: 0.098GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_minus_coverage.bed (395977)


Command completed. Elapsed time: 0:04:36. Running peak memory: 1.021GB.
PID: 395977; Command: bedtools; Return code: 0; Memory used: 0.166GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR" (396492)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 396492; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR_sort.bed (396493,396494,396495,396496)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 396493; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 396494; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 396496; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 396495; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_plus_coverage.bed (396500)


Command completed. Elapsed time: 0:04:30. Running peak memory: 1.021GB.
PID: 396500; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_minus_coverage.bed (414548)


Command completed. Elapsed time: 0:04:12. Running peak memory: 1.021GB.
PID: 414548; Command: bedtools; Return code: 0; Memory used: 0.063GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR" (419328)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 419328; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR_sort.bed (419329,419330,419331,419332)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 419329; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 419330; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 419332; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 419331; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_plus_coverage.bed (419335)


Command completed. Elapsed time: 0:04:40. Running peak memory: 1.021GB.
PID: 419335; Command: bedtools; Return code: 0; Memory used: 0.104GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_minus_coverage.bed (419820)


Command completed. Elapsed time: 0:04:35. Running peak memory: 1.021GB.
PID: 419820; Command: bedtools; Return code: 0; Memory used: 0.162GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon_sort.bed (422032,422069,422085,422089)


Command completed. Elapsed time: 0:00:03. Running peak memory: 1.021GB.
PID: 422032; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 422069; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 422089; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 422085; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_plus_coverage.bed (424370)


Command completed. Elapsed time: 0:05:25. Running peak memory: 1.021GB.
PID: 424370; Command: bedtools; Return code: 0; Memory used: 0.468GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_minus_coverage.bed (456033)


Command completed. Elapsed time: 0:05:15. Running peak memory: 1.021GB.
PID: 456033; Command: bedtools; Return code: 0; Memory used: 0.186GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron_sort.bed (29395,29396,29397,29398)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 29395; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 29397; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 29396; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 29398; Command: bedtools; Return code: 0; Memory used: 0.085GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_plus_coverage.bed (29402)


Command completed. Elapsed time: 0:06:15. Running peak memory: 1.021GB.
PID: 29402; Command: bedtools; Return code: 0; Memory used: 0.453GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_minus_coverage.bed (57734)


Command completed. Elapsed time: 0:06:21. Running peak memory: 1.021GB.
PID: 57734; Command: bedtools; Return code: 0; Memory used: 0.434GB

Plot cFRiF/FRiF (06-14 22:46:31) elapsed: 4139.0 TIME

samtools view -@ 32 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_PRO-seq_100 -z 3099922541 -n 192750289 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_plus_coverage.bed (80398)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:46. Running peak memory: 1.021GB.
PID: 80398; Command: Rscript; Return code: 0; Memory used: 0.831GB

cFRiF QC_hg38/K562_PRO-seq_100_cFRiF.pdf cFRiF QC_hg38/K562_PRO-seq_100_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_PRO-seq_100 -z 3099922541 -n 192750289 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_Intron_plus_coverage.bed (80459)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:29. Running peak memory: 1.021GB.
PID: 80459; Command: Rscript; Return code: 0; Memory used: 0.439GB

FRiF QC_hg38/K562_PRO-seq_100_FRiF.pdf FRiF QC_hg38/K562_PRO-seq_100_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-14 22:48:18) elapsed: 106.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_exons_sort.bed (80502,80503)


Command completed. Elapsed time: 0:00:05. Running peak memory: 1.021GB.
PID: 80503; Command: bedtools; Return code: 0; Memory used: 0.094GB
PID: 80502; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_introns_sort.bed (80512,80513,80514)


Command completed. Elapsed time: 0:00:05. Running peak memory: 1.021GB.
PID: 80512; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 80514; Command: bedtools; Return code: 0; Memory used: 0.004GB
PID: 80513; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_coverage.bed (80522)


Command completed. Elapsed time: 0:09:42. Running peak memory: 1.021GB.
PID: 80522; Command: bedtools; Return code: 0; Memory used: 0.293GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_coverage.bed (131120)


Command completed. Elapsed time: 0:13:29. Running peak memory: 1.021GB.
PID: 131120; Command: bedtools; Return code: 0; Memory used: 0.487GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/387.328746)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_rpkm.bed (193263,193271,193272)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 193263; Command: awk; Return code: 0; Memory used: 0.006GB
PID: 193272; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 193271; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/387.328746)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_rpkm.bed (193274,193275,193276)


Command completed. Elapsed time: 0:00:01. Running peak memory: 1.021GB.
PID: 193274; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 193276; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 193275; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed (193279,193280,193281)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 193279; Command: join; Return code: 0; Memory used: 0.001GB
PID: 193281; Command: sort; Return code: 0; Memory used: 0.006GB
PID: 193280; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 1.37 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed --annotate (193287)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 1.021GB.
PID: 193287; Command: Rscript; Return code: 0; Memory used: 0.208GB

mRNA contamination QC_hg38/K562_PRO-seq_100_mRNA_contamination.pdf mRNA contamination QC_hg38/K562_PRO-seq_100_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed.gz

pigz -f -p 32 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/QC_hg38/K562_PRO-seq_100_exon_intron_ratios.bed (193318)


Command completed. Elapsed time: 0:00:00. Running peak memory: 1.021GB.
PID: 193318; Command: pigz; Return code: 0; Memory used: 0.005GB

Produce bigWig files (06-14 23:11:46) elapsed: 1408.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam (193327)


Command completed. Elapsed time: 0:03:00. Running peak memory: 1.021GB.
PID: 193327; Command: samtools; Return code: 0; Memory used: 0.019GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_smooth_body_0-mer.bw -p 21 --variable-step --tail-edge --scale 387328746.0 (193512)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_plus.bam'
Temporary files will be stored in: 'tmp_K562_PRO-seq_100_plus_cuttrace_l2uwmwym'
Processing with 10 cores...
stdin is empty of data
stdin is empty of data
stdin is empty of data
Discarding 90 chunk(s) of reads: ['chrM', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1']
Keeping 105 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270709v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270538v1', 'chrUn_KI270580v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270333v1', 'chrUn_KI270337v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 105 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_exact_body_0-mer.bw'
Merging 105 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:08:30. Running peak memory: 3.847GB.
PID: 193512; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 3.847GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam (195542)


Command completed. Elapsed time: 0:03:07. Running peak memory: 3.847GB.
PID: 195542; Command: samtools; Return code: 0; Memory used: 0.019GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_smooth_body_0-mer.bw -p 21 --variable-step --tail-edge --scale 387328746.0 (195934)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/aligned_hg38/K562_PRO-seq_100_minus.bam'
Temporary files will be stored in: 'tmp_K562_PRO-seq_100_minus_cuttrace_l74fklbt'
Processing with 10 cores...
stdin is empty of data
psutil.NoSuchProcess process no longer exists (pid=195985)
Warning: couldn't add memory use for process: 195934
stdin is empty of data
stdin is empty of data
stdin is empty of data
stdin is empty of data
psutil.NoSuchProcess process no longer exists (pid=196723)
Warning: couldn't add memory use for process: 195934
Discarding 93 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270755v1']
Keeping 102 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270310v1', 'chrUn_KI270411v1', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270581v1', 'chrUn_KI270589v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270336v1', 'chrUn_KI270448v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 102 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_exact_body_0-mer.bw'
Merging 102 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_PRO-seq_100/signal_hg38/K562_PRO-seq_100_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:08:09. Running peak memory: 4.216GB.
PID: 195934; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 4.216GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 2:23:44
  • Total elapsed time (all runs): 13:29:45
  • Peak memory (this run): 4.2155 GB
  • Pipeline completed time: 2020-06-14 23:34:32