Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_20 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty
  • Compute host: udc-aj37-17c1
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/
  • Pipeline started at: (06-11 17:08:26) elapsed: 1.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: False
  • sample_name: K562_RNA-seq_20
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz

File_mb 5645.61 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz (423045)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 423045; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1.fastq (423046)


Command completed. Elapsed time: 0:02:33. Running peak memory: 0.002GB.
PID: 423046; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 70000000 PEPPRO RES

Fastq_reads 70000000 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz']

FASTQ processing: (06-11 17:13:12) elapsed: 284.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq

(cutadapt -j 12 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt (423689)


Command completed. Elapsed time: 0:02:12. Running peak memory: 4.633GB.
PID: 423689; Command: cutadapt; Return code: 0; Memory used: 4.633GB

seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_noadap.fastq | seqtk seq -L 2 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq (424071,424072)


Command completed. Elapsed time: 0:02:03. Running peak memory: 4.633GB.
PID: 424071; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 424072; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 52676382.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 1401144.0 PEPPRO RES

Pct_uninformative_adapter_reads 2.0016 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastqc/K562_RNA-seq_20_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (424689)

Calculate the number of trimmed reads

Command completed. Elapsed time: 0:00:00. Running peak memory: 4.633GB.
PID: 424689; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 68598856 PEPPRO RES

Trim_loss_rate 2.0 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq (424723)


Got SIGTERM. Failing gracefully... (06-11 18:55:14) elapsed: 6122.0 TIME
Child process 424723 (fastqc) terminated after 0 sec.
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/recover.lock.fastqc__K562_RNA-seq_20_R1_processed_fastqc.html
Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/recover.lock.trimmed_fastqc

Pipeline failed at: (06-11 18:55:14) elapsed: 0.0 TIME

Total time: 1:46:48 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_20 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aw29-25a
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/
  • Pipeline started at: (06-11 19:08:12) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_RNA-seq_20
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/PEPPRO_failed.flag' Local input file: /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz

File_mb 5645.61 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz']

FASTQ processing: (06-11 19:08:13) elapsed: 0.0 TIME

cutadapt --version Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq
Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/lock.fastqc__K562_RNA-seq_20_R1_processed_fastqc.html Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastqc/K562_RNA-seq_20_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (73596)

Calculate the number of trimmed reads


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 73596; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 68598856 PEPPRO RES

Trim_loss_rate 2.0 PEPPRO RES Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/lock.trimmed_fastqc Overwriting target... Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq (73624)

Started analysis of K562_RNA-seq_20_R1_processed.fastq
Approx 5% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 10% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 15% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 20% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 25% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 30% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 35% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 40% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 45% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 50% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 55% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 60% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 65% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 70% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 75% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 80% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 85% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 90% complete for K562_RNA-seq_20_R1_processed.fastq
Approx 95% complete for K562_RNA-seq_20_R1_processed.fastq
Analysis complete for K562_RNA-seq_20_R1_processed.fastq
Command completed. Elapsed time: 0:04:16. Running peak memory: 0.241GB.
PID: 73624; Command: fastqc; Return code: 0; Memory used: 0.241GB

FastQC report r1 fastqc/K562_RNA-seq_20_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/processed_R1.flag (74533)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.241GB.
PID: 74533; Command: touch; Return code: 0; Memory used: 0.002GB

Plot adapter insertion distribution (06-11 19:12:48) elapsed: 276.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt (74534)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.241GB.
PID: 74534; Command: Rscript; Return code: 0; Memory used: 0.203GB

Adapter insertion distribution cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 34 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-11 19:12:55) elapsed: 6.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.231 PEPPRO RES

Prealignments (06-11 19:12:55) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 19:12:55) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_RNA-seq_20 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 68598856 reads; of these: 68598856 (100.00%) were unpaired; of these: 63236574 (92.18%) aligned 0 times 5362282 (7.82%) aligned exactly 1 time 0 (0.00%) aligned >1 times 7.82% overall alignment rate

Aligned_reads_human_rDNA 5362282.0 PEPPRO RES

Alignment_rate_human_rDNA 7.82 PEPPRO RES

Map to genome (06-11 19:20:03) elapsed: 428.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id K562_RNA-seq_20 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/tmpamatz2sy -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam (75996,76008,76009)

63236574 reads; of these:
  63236574 (100.00%) were unpaired; of these:
    2913471 (4.61%) aligned 0 times
    43731750 (69.16%) aligned exactly 1 time
    16591353 (26.24%) aligned >1 times
95.39% overall alignment rate
[bam_sort_core] merging from 20 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:42:29. Running peak memory: 3.719GB.
PID: 76008; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 75996; Command: bowtie2; Return code: 0; Memory used: 3.719GB
PID: 76009; Command: samtools; Return code: 0; Memory used: 0.889GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam (81767)


Command completed. Elapsed time: 0:02:14. Running peak memory: 3.719GB.
PID: 81767; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 60323103 PEPPRO RES

QC_filtered_reads 7805805 PEPPRO RES

Aligned_reads 52517298 PEPPRO RES

Alignment_rate 76.56 PEPPRO RES

Total_efficiency 75.02 PEPPRO RES

Read_depth 6.01 PEPPRO RES

Compress all unmapped read files (06-11 20:26:31) elapsed: 3988.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq (85465)


Command completed. Elapsed time: 0:02:15. Running peak memory: 3.719GB.
PID: 85465; Command: pigz; Return code: 0; Memory used: 0.009GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam (85727)


Command completed. Elapsed time: 0:01:03. Running peak memory: 3.719GB.
PID: 85727; Command: samtools; Return code: 0; Memory used: 0.017GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 1870021 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam (85787)


Command completed. Elapsed time: 0:00:52. Running peak memory: 3.719GB.
PID: 85787; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/chr_sizes.bed (86149,86150,86151,86152)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 86150; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 86152; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 86149; Command: samtools; Return code: 0; Memory used: 0.008GB
PID: 86151; Command: awk; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_noMT.bam (86154)


Command completed. Elapsed time: 0:01:06. Running peak memory: 3.719GB.
PID: 86154; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam (86228)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 86228; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam (86229)


Command completed. Elapsed time: 0:00:51. Running peak memory: 3.719GB.
PID: 86229; Command: samtools; Return code: 0; Memory used: 0.016GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 100 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-11 20:35:26) elapsed: 535.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv (86907)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmp_K562_RNA-seq_20_sort_j38_hdoq'
Processing with 12 cores...
Discarding 98 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270725v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 97 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:01:13. Running peak memory: 3.719GB.
PID: 86907; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.567GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv

NRF 0.77 PEPPRO RES

PBC1 0.9 PEPPRO RES

PBC2 12.6 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_unmap.bam (87002)


Command completed. Elapsed time: 0:00:14. Running peak memory: 3.719GB.
PID: 87002; Command: samtools; Return code: 0; Memory used: 0.009GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_temp.bam

Unmapped_reads 2913471 PEPPRO RES

Split BAM by strand (06-11 20:37:03) elapsed: 97.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam (87055)


Command completed. Elapsed time: 0:04:12. Running peak memory: 3.719GB.
PID: 87055; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam (87688)


Command completed. Elapsed time: 0:04:04. Running peak memory: 3.719GB.
PID: 87688; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-11 20:45:19) elapsed: 496.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (88288)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 88288; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_plus_TssEnrichment.txt (88289)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.719GB.
PID: 88289; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.535GB

TSS_coding_score 16.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_minus_TssEnrichment.txt (88325)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.719GB.
PID: 88325; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.545GB

TSS_non-coding_score 5.2 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_minus_TssEnrichment.txt (88358)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 3.719GB.
PID: 88358; Command: Rscript; Return code: 0; Memory used: 0.286GB

TSS enrichment QC_hg38/K562_RNA-seq_20_TSSenrichment.pdf TSS enrichment QC_hg38/K562_RNA-seq_20_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt (88383,88384,88385,88386)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 88383; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 88385; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 88384; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 88386; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt (88389)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 88389; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-11 20:45:44) elapsed: 25.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_tss.bed (88391,88392)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.719GB.
PID: 88391; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 88392; Command: bedtools; Return code: 0; Memory used: 0.097GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_gene_body.bed (88395,88396)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 88395; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 88396; Command: bedtools; Return code: 0; Memory used: 0.022GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSS_density.bed (88398,88399,88400,88401)


Command completed. Elapsed time: 0:01:18. Running peak memory: 3.719GB.
PID: 88399; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 88401; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 88398; Command: bedtools; Return code: 0; Memory used: 0.019GB
PID: 88400; Command: sort; Return code: 0; Memory used: 0.007GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_gene_body_density.bed (88472,88473,88474)


Command completed. Elapsed time: 0:01:46. Running peak memory: 3.719GB.
PID: 88472; Command: bedtools; Return code: 0; Memory used: 0.147GB
PID: 88474; Command: sort; Return code: 0; Memory used: 0.007GB
PID: 88473; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmpjvy_9kf9 (88813,88818,88825)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.719GB.
PID: 88813; Command: join; Return code: 0; Memory used: 0.001GB
PID: 88825; Command: env; Return code: 0; Memory used: 0.004GB
PID: 88818; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmpjvy_9kf9 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]} /bin/sh: -c: line 0: unexpected EOF while looking for matching `'' /bin/sh: -c: line 1: syntax error: unexpected end of file

Pipeline failed at: (06-11 20:48:50) elapsed: 187.0 TIME

Total time: 1:40:39 Failure reason: Command 'awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmpjvy_9kf9 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' returned non-zero exit status 1.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_20 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-12c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/
  • Pipeline started at: (06-14 21:11:24) elapsed: 7.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_RNA-seq_20
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/PEPPRO_failed.flag' Local input file: /project/shefflab/data//guertin/fastq/K562_20pctRNA.fastq.gz

File_mb 5645.61 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/K562_RNA-seq_20_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/K562_RNA-seq_20.fastq.gz']

FASTQ processing: (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/fastq/processed_R1.flag

Plot adapter insertion distribution (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_RNA-seq_20_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-14 21:11:25) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-14 21:11:25) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq

Map to genome (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam

Compress all unmapped read files (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/prealignments/K562_RNA-seq_20_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_unmap.bam

Split BAM by strand (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam

Calculate TSS enrichment (06-14 21:11:25) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSSenrichment.pdf

TSS enrichment QC_hg38/K562_RNA-seq_20_TSSenrichment.pdf TSS enrichment QC_hg38/K562_RNA-seq_20_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-14 21:11:25) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_gene_body_density.bed
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmphykfnbhi (126375,126388,126389)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 126375; Command: join; Return code: 0; Memory used: 0.001GB
PID: 126389; Command: env; Return code: 0; Memory used: 0.004GB
PID: 126388; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmphykfnbhi | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0418746) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/tmphykfnbhi > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed (126716)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 126716; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 9.34 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed (126807)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 0.316GB.
PID: 126807; Command: Rscript; Return code: 0; Memory used: 0.316GB

Pause index QC_hg38/K562_RNA-seq_20_pause_index.pdf Pause index QC_hg38/K562_RNA-seq_20_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_pause_index.bed (130838)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 130838; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-14 21:11:31) elapsed: 6.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam 52517298 19111627

Plus_FRiP 0.36 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam 52517298 18420080

Minus_FRiP 0.35 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_gene_sort.bed (168513,168514)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 168513; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 168514; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_gene_coverage.bed (168516)


Command completed. Elapsed time: 0:01:43. Running peak memory: 0.316GB.
PID: 168516; Command: bedtools; Return code: 0; Memory used: 0.142GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed.gz (227608)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 227608; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed (227625)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 227625; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-14 21:14:45) elapsed: 194.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/raw/hg38_annotations.bed (227794)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 227794; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer_sort.bed (228186,228193,228195,228196)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 228186; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 228193; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 228196; Command: bedtools; Return code: 0; Memory used: 0.044GB
PID: 228195; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_plus_coverage.bed (228419)


Command completed. Elapsed time: 0:00:38. Running peak memory: 0.316GB.
PID: 228419; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_minus_coverage.bed (238525)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.316GB.
PID: 238525; Command: bedtools; Return code: 0; Memory used: 0.016GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_sort.bed (240355,240357,240358,240359)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 240355; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 240357; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 240359; Command: bedtools; Return code: 0; Memory used: 0.008GB
PID: 240358; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_plus_coverage.bed (240361)


Command completed. Elapsed time: 0:00:41. Running peak memory: 0.316GB.
PID: 240361; Command: bedtools; Return code: 0; Memory used: 0.05GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_minus_coverage.bed (256916)


Command completed. Elapsed time: 0:00:39. Running peak memory: 0.316GB.
PID: 256916; Command: bedtools; Return code: 0; Memory used: 0.067GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region" (261226)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 261226; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region_sort.bed (261247,261248,261249,261251)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 261247; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 261249; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 261248; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 261251; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_plus_coverage.bed (261586)


Command completed. Elapsed time: 0:00:39. Running peak memory: 0.316GB.
PID: 261586; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_minus_coverage.bed (262527)


Command completed. Elapsed time: 0:00:38. Running peak memory: 0.316GB.
PID: 262527; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR" (281178)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 281178; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR_sort.bed (281224,281231,281245,281246)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 281224; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 281231; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 281246; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 281245; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_plus_coverage.bed (281837)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.316GB.
PID: 281837; Command: bedtools; Return code: 0; Memory used: 0.015GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_minus_coverage.bed (295622)


Command completed. Elapsed time: 0:00:35. Running peak memory: 0.316GB.
PID: 295622; Command: bedtools; Return code: 0; Memory used: 0.013GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR" (299614)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.316GB.
PID: 299614; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR_sort.bed (299667,299668,299670,299675)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 299667; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 299668; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 299675; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 299670; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_plus_coverage.bed (300252)


Command completed. Elapsed time: 0:00:38. Running peak memory: 0.316GB.
PID: 300252; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_minus_coverage.bed (321585)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.316GB.
PID: 321585; Command: bedtools; Return code: 0; Memory used: 0.025GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon_sort.bed (340484,340504,340517,340524)


Command completed. Elapsed time: 0:00:03. Running peak memory: 0.316GB.
PID: 340484; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 340504; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 340524; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 340517; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_plus_coverage.bed (342698)


Command completed. Elapsed time: 0:00:42. Running peak memory: 0.316GB.
PID: 342698; Command: bedtools; Return code: 0; Memory used: 0.052GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_minus_coverage.bed (377941)


Command completed. Elapsed time: 0:00:39. Running peak memory: 0.316GB.
PID: 377941; Command: bedtools; Return code: 0; Memory used: 0.03GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron_sort.bed (395286,395287,395288,395289)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.316GB.
PID: 395286; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 395288; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 395287; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 395289; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_plus_coverage.bed (395292)


Command completed. Elapsed time: 0:00:40. Running peak memory: 0.316GB.
PID: 395292; Command: bedtools; Return code: 0; Memory used: 0.052GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_minus_coverage.bed (395335)


Command completed. Elapsed time: 0:00:39. Running peak memory: 0.316GB.
PID: 395335; Command: bedtools; Return code: 0; Memory used: 0.063GB

Plot cFRiF/FRiF (06-14 21:23:52) elapsed: 547.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_20 -z 3099922541 -n 25794529 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_plus_coverage.bed (411009)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:36. Running peak memory: 0.521GB.
PID: 411009; Command: Rscript; Return code: 0; Memory used: 0.521GB

cFRiF QC_hg38/K562_RNA-seq_20_cFRiF.pdf cFRiF QC_hg38/K562_RNA-seq_20_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_20 -z 3099922541 -n 25794529 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_Intron_plus_coverage.bed (422648)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:27. Running peak memory: 0.521GB.
PID: 422648; Command: Rscript; Return code: 0; Memory used: 0.48GB

FRiF QC_hg38/K562_RNA-seq_20_FRiF.pdf FRiF QC_hg38/K562_RNA-seq_20_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-14 21:24:59) elapsed: 67.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_exons_sort.bed (430189,430190)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.521GB.
PID: 430190; Command: bedtools; Return code: 0; Memory used: 0.086GB
PID: 430189; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_introns_sort.bed (432559,432564,432574)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.521GB.
PID: 432559; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 432574; Command: bedtools; Return code: 0; Memory used: 0.003GB
PID: 432564; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_coverage.bed (435917)


Command completed. Elapsed time: 0:01:18. Running peak memory: 0.521GB.
PID: 435917; Command: bedtools; Return code: 0; Memory used: 0.054GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_coverage.bed (8315)


Command completed. Elapsed time: 0:01:24. Running peak memory: 0.521GB.
PID: 8315; Command: bedtools; Return code: 0; Memory used: 0.056GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/52.517298)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_rpkm.bed (20269,20270,20271)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.521GB.
PID: 20269; Command: awk; Return code: 0; Memory used: 0.006GB
PID: 20271; Command: sort; Return code: 0; Memory used: 0.003GB
PID: 20270; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/52.517298)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_rpkm.bed (20564,20581,20589)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.521GB.
PID: 20564; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 20589; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 20581; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed (21011,21018,21021)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.521GB.
PID: 21011; Command: join; Return code: 0; Memory used: 0.001GB
PID: 21021; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 21018; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 2.46 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed --annotate (21397)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 0.521GB.
PID: 21397; Command: Rscript; Return code: 0; Memory used: 0.316GB

mRNA contamination QC_hg38/K562_RNA-seq_20_mRNA_contamination.pdf mRNA contamination QC_hg38/K562_RNA-seq_20_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/QC_hg38/K562_RNA-seq_20_exon_intron_ratios.bed (24987)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.521GB.
PID: 24987; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-14 21:27:59) elapsed: 180.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam (25042)


Command completed. Elapsed time: 0:00:24. Running peak memory: 0.521GB.
PID: 25042; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 52517298.0 (36734)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_plus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_20_plus_cuttrace_v1djjzzz'
Processing with 4 cores...
stdin is empty of data
Discarding 108 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr22_KI270732v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 87 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 87 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_exact_body_0-mer.bw'
Merging 87 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:08:10. Running peak memory: 2.595GB.
PID: 36734; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.595GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam (187214)


Command completed. Elapsed time: 0:00:23. Running peak memory: 2.595GB.
PID: 187214; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 52517298.0 (187252)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/aligned_hg38/K562_RNA-seq_20_minus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_20_minus_cuttrace_lsuaimff'
Processing with 4 cores...
stdin is empty of data
Discarding 110 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr1_KI270712v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_KI270723v1_random', 'chr14_KI270725v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1']
Keeping 85 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270589v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 85 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_exact_body_0-mer.bw'
Merging 85 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_20/signal_hg38/K562_RNA-seq_20_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:52. Running peak memory: 2.612GB.
PID: 187252; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.612GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 0:33:30
  • Total elapsed time (all runs): 2:54:20
  • Peak memory (this run): 2.6121 GB
  • Pipeline completed time: 2020-06-14 21:44:47