Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_40 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty
  • Compute host: udc-aw29-25b
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/
  • Pipeline started at: (06-11 17:13:57) elapsed: 7.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: False
  • sample_name: K562_RNA-seq_40
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz

File_mb 5584.92 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz (388389)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.0GB.
PID: 388389; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1.fastq (388390)


Command completed. Elapsed time: 0:02:21. Running peak memory: 0.002GB.
PID: 388390; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 70000000 PEPPRO RES

Fastq_reads 70000000 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz']

FASTQ processing: (06-11 17:17:51) elapsed: 233.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq

(cutadapt -j 12 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt (390042)


Command completed. Elapsed time: 0:02:05. Running peak memory: 4.637GB.
PID: 390042; Command: cutadapt; Return code: 0; Memory used: 4.637GB

seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_noadap.fastq | seqtk seq -L 2 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq (390564,390565)


Command completed. Elapsed time: 0:01:46. Running peak memory: 4.637GB.
PID: 390564; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 390565; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 45723195.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 1050230.0 PEPPRO RES

Pct_uninformative_adapter_reads 1.5003 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastqc/K562_RNA-seq_40_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (391558)

Calculate the number of trimmed reads


Command completed. Elapsed time: 0:00:00. Running peak memory: 4.637GB.
PID: 391558; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 68949770 PEPPRO RES

Trim_loss_rate 1.5 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq (391626)

Started analysis of K562_RNA-seq_40_R1_processed.fastq
Got SIGTERM. Failing gracefully... (06-11 18:55:14) elapsed: 5843.0 TIME Child process 391626 (fastqc) terminated after 0 sec. Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/recover.lock.fastqc__K562_RNA-seq_40_R1_processed_fastqc.html Setting dynamic recover file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/recover.lock.trimmed_fastqc

Pipeline failed at: (06-11 18:55:14) elapsed: 0.0 TIME

Total time: 1:41:25 Failure reason: SIGTERM Pipeline aborted.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_40 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-ba25-32c0
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/
  • Pipeline started at: (06-11 19:08:40) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_RNA-seq_40
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/PEPPRO_failed.flag' Local input file: /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz

File_mb 5584.92 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz']

FASTQ processing: (06-11 19:08:40) elapsed: 0.0 TIME

cutadapt --version Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq
Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/lock.fastqc__K562_RNA-seq_40_R1_processed_fastqc.html Overwriting target... Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastqc/K562_RNA-seq_40_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (82210)

Calculate the number of trimmed reads


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 82210; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 68949770 PEPPRO RES

Trim_loss_rate 1.5 PEPPRO RES Found lock file: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/lock.trimmed_fastqc Overwriting target... Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq (82232)

Started analysis of K562_RNA-seq_40_R1_processed.fastq
Approx 5% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 10% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 15% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 20% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 25% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 30% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 35% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 40% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 45% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 50% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 55% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 60% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 65% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 70% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 75% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 80% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 85% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 90% complete for K562_RNA-seq_40_R1_processed.fastq
Approx 95% complete for K562_RNA-seq_40_R1_processed.fastq
Analysis complete for K562_RNA-seq_40_R1_processed.fastq

A fatal error has been detected by the Java Runtime Environment:

SIGSEGV (0xb) at pc=0x00007f3d15fe58a9, pid=82232, tid=0x00007f3cfaae7700

JRE version: Java(TM) SE Runtime Environment (8.0_171-b11) (build 1.8.0_171-b11)

Java VM: Java HotSpot(TM) 64-Bit Server VM (25.171-b11 mixed mode linux-amd64 compressed oops)

Problematic frame:

V [libjvm.so+0x6e08a9] jni_ReleasePrimitiveArrayCritical+0x69

Core dump written. Default location: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/core or core.82232

An error report file with more information is saved as:

/sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/hs_err_pid82232.log

If you would like to submit a bug report, please visit:

http://bugreport.java.com/bugreport/crash.jsp

Command completed. Elapsed time: 0:03:56. Running peak memory: 0.243GB.
PID: 82232; Command: fastqc; Return code: -6; Memory used: 0.243GB

Subprocess returned nonzero result. Check above output for details ERROR: Subprocess returned nonzero result, but pipeline is continuing because nofail=True

FastQC report r1 fastqc/K562_RNA-seq_40_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/processed_R1.flag (82836)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.243GB.
PID: 82836; Command: touch; Return code: 0; Memory used: 0.002GB

Plot adapter insertion distribution (06-11 19:12:51) elapsed: 251.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt (82837)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.243GB.
PID: 82837; Command: Rscript; Return code: 0; Memory used: 0.204GB

Adapter insertion distribution cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 34 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-11 19:12:57) elapsed: 6.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.2309 PEPPRO RES

Prealignments (06-11 19:12:57) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-11 19:12:57) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_RNA-seq_40 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 68949770 reads; of these: 68949770 (100.00%) were unpaired; of these: 64521780 (93.58%) aligned 0 times 4427990 (6.42%) aligned exactly 1 time 0 (0.00%) aligned >1 times 6.42% overall alignment rate

Aligned_reads_human_rDNA 4427990.0 PEPPRO RES

Alignment_rate_human_rDNA 6.42 PEPPRO RES

Map to genome (06-11 19:20:50) elapsed: 473.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id K562_RNA-seq_40 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/tmph12anwx9 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam (84828,84833,84834)

64521780 reads; of these:
  64521780 (100.00%) were unpaired; of these:
    5066898 (7.85%) aligned 0 times
    41197278 (63.85%) aligned exactly 1 time
    18257604 (28.30%) aligned >1 times
92.15% overall alignment rate
[bam_sort_core] merging from 20 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:39:43. Running peak memory: 3.718GB.
PID: 84833; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 84828; Command: bowtie2; Return code: 0; Memory used: 3.718GB
PID: 84834; Command: samtools; Return code: 0; Memory used: 0.889GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam (90348)


Command completed. Elapsed time: 0:02:39. Running peak memory: 3.718GB.
PID: 90348; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 59454882 PEPPRO RES

QC_filtered_reads 9022968 PEPPRO RES

Aligned_reads 50431914 PEPPRO RES

Alignment_rate 73.14 PEPPRO RES

Total_efficiency 72.05 PEPPRO RES

Read_depth 6.34 PEPPRO RES

Compress all unmapped read files (06-11 20:24:00) elapsed: 3789.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq (93635)


Command completed. Elapsed time: 0:02:24. Running peak memory: 3.718GB.
PID: 93635; Command: pigz; Return code: 0; Memory used: 0.009GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam (93989)


Command completed. Elapsed time: 0:01:05. Running peak memory: 3.718GB.
PID: 93989; Command: samtools; Return code: 0; Memory used: 0.017GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 2452024 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam (94164)


Command completed. Elapsed time: 0:00:51. Running peak memory: 3.718GB.
PID: 94164; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/chr_sizes.bed (94209,94210,94211,94212)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 94209; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 94211; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 94210; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 94212; Command: grep; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_noMT.bam (94215)


Command completed. Elapsed time: 0:01:04. Running peak memory: 3.718GB.
PID: 94215; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam (94285)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.718GB.
PID: 94285; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam (94287)


Command completed. Elapsed time: 0:00:49. Running peak memory: 3.718GB.
PID: 94287; Command: samtools; Return code: 0; Memory used: 0.016GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 100 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-11 20:32:52) elapsed: 533.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv (95006)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmp_K562_RNA-seq_40_sort_4vnlq6cu'
Processing with 12 cores...
Discarding 97 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 98 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:01:11. Running peak memory: 3.718GB.
PID: 95006; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.424GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv

NRF 0.75 PEPPRO RES

PBC1 0.9 PEPPRO RES

PBC2 13.91 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_unmap.bam (95120)


Command completed. Elapsed time: 0:00:17. Running peak memory: 3.718GB.
PID: 95120; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_temp.bam

Unmapped_reads 5066898 PEPPRO RES

Split BAM by strand (06-11 20:34:31) elapsed: 98.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam (95171)


Command completed. Elapsed time: 0:04:00. Running peak memory: 3.718GB.
PID: 95171; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam (96009)


Command completed. Elapsed time: 0:03:52. Running peak memory: 3.718GB.
PID: 96009; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-11 20:42:23) elapsed: 472.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (96752)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 96752; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_plus_TssEnrichment.txt (96753)


Command completed. Elapsed time: 0:00:10. Running peak memory: 3.718GB.
PID: 96753; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.53GB

TSS_coding_score 16.6 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_minus_TssEnrichment.txt (96791)


Command completed. Elapsed time: 0:00:08. Running peak memory: 3.718GB.
PID: 96791; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.541GB

TSS_non-coding_score 5.0 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_minus_TssEnrichment.txt (96824)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 3.718GB.
PID: 96824; Command: Rscript; Return code: 0; Memory used: 0.316GB

TSS enrichment QC_hg38/K562_RNA-seq_40_TSSenrichment.pdf TSS enrichment QC_hg38/K562_RNA-seq_40_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt (96846,96847,96848,96849)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 96846; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 96848; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 96847; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 96849; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt (96851)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 96851; Command: cut; Return code: 0; Memory used: 0.002GB

Calculate Pause Index (PI) (06-11 20:42:47) elapsed: 24.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_tss.bed (96853,96854)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.718GB.
PID: 96853; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 96854; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_gene_body.bed (96857,96858)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 96857; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 96858; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSS_density.bed (96861,96862,96863,96864)


Command completed. Elapsed time: 0:01:15. Running peak memory: 3.718GB.
PID: 96862; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 96864; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 96861; Command: bedtools; Return code: 0; Memory used: 0.032GB
PID: 96863; Command: sort; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_gene_body_density.bed (96930,96931,96932)


Command completed. Elapsed time: 0:01:46. Running peak memory: 3.718GB.
PID: 96930; Command: bedtools; Return code: 0; Memory used: 0.176GB
PID: 96932; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 96931; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmpd3fxoegt (97232,97233,97234)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.718GB.
PID: 97232; Command: join; Return code: 0; Memory used: 0.001GB
PID: 97234; Command: env; Return code: 0; Memory used: 0.004GB
PID: 97233; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmpd3fxoegt | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]} /bin/sh: -c: line 0: unexpected EOF while looking for matching `'' /bin/sh: -c: line 1: syntax error: unexpected end of file

Pipeline failed at: (06-11 20:45:51) elapsed: 183.0 TIME

Total time: 1:37:11 Failure reason: Command 'awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmpd3fxoegt | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' returned non-zero exit status 1.

Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_40 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aw29-23a
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/
  • Pipeline started at: (06-14 21:11:55) elapsed: 7.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16373 insertions(+), 3522 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_RNA-seq_40
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Removed existing flag: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/PEPPRO_failed.flag' Local input file: /project/shefflab/data//guertin/fastq/K562_40pctRNA.fastq.gz

File_mb 5584.92 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz
Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz' Found .fastq.gz file Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/K562_RNA-seq_40_R1.fastq
['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/K562_RNA-seq_40.fastq.gz']

FASTQ processing: (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/fastq/processed_R1.flag

Plot adapter insertion distribution (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.pdf

Adapter insertion distribution cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_RNA-seq_40_R1_adapter_insertion_distribution.png PEPPRO OBJ

Prealignments (06-14 21:11:55) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-14 21:11:55) elapsed: 0.0 TIME

No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq

Map to genome (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam

Compress all unmapped read files (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/prealignments/K562_RNA-seq_40_human_rDNA_unmap.fq.gz

Calculate NRF, PBC1, and PBC2 (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam.bai
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_bamQC.tsv
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_unmap.bam

Split BAM by strand (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam

Calculate TSS enrichment (06-14 21:11:55) elapsed: 0.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSSenrichment.pdf

TSS enrichment QC_hg38/K562_RNA-seq_40_TSSenrichment.pdf TSS enrichment QC_hg38/K562_RNA-seq_40_TSSenrichment.png PEPPRO OBJ

Calculate Pause Index (PI) (06-14 21:11:55) elapsed: 0.0 TIME

Missing stat 'Pause_index' Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_tss.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_ensembl_gene_body.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSS_density.bed
Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_gene_body_density.bed
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmp62k_foj0 (274384,274385,274386)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 274384; Command: join; Return code: 0; Memory used: 0.001GB
PID: 274386; Command: env; Return code: 0; Memory used: 0.004GB
PID: 274385; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmp62k_foj0 | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0411612) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/tmp62k_foj0 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed (274393)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.004GB.
PID: 274393; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 8.63 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed (274398)

Pause index plot completed!

Command completed. Elapsed time: 0:00:06. Running peak memory: 0.251GB.
PID: 274398; Command: Rscript; Return code: 0; Memory used: 0.251GB

Pause index QC_hg38/K562_RNA-seq_40_pause_index.pdf Pause index QC_hg38/K562_RNA-seq_40_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_pause_index.bed (274421)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 274421; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-14 21:12:02) elapsed: 6.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam 50431914 18750392

Plus_FRiP 0.37 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam 50431914 18315541

Minus_FRiP 0.36 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_gene_sort.bed (285553,285574)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 285553; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 285574; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_gene_coverage.bed (286228)


Command completed. Elapsed time: 0:01:36. Running peak memory: 0.251GB.
PID: 286228; Command: bedtools; Return code: 0; Memory used: 0.126GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed.gz (318793)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 318793; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed (318795)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 318795; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-14 21:15:05) elapsed: 183.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/raw/hg38_annotations.bed (318803)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 318803; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer_sort.bed (318805,318806,318807,318808)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 318805; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 318806; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 318808; Command: bedtools; Return code: 0; Memory used: 0.044GB
PID: 318807; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_plus_coverage.bed (318811)


Command completed. Elapsed time: 0:00:34. Running peak memory: 0.251GB.
PID: 318811; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_minus_coverage.bed (318846)


Command completed. Elapsed time: 0:00:33. Running peak memory: 0.251GB.
PID: 318846; Command: bedtools; Return code: 0; Memory used: 0.024GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_sort.bed (318878,318879,318880,318881)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 318878; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 318879; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 318881; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 318880; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_plus_coverage.bed (318884)


Command completed. Elapsed time: 0:00:35. Running peak memory: 0.251GB.
PID: 318884; Command: bedtools; Return code: 0; Memory used: 0.088GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_minus_coverage.bed (318914)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.251GB.
PID: 318914; Command: bedtools; Return code: 0; Memory used: 0.066GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region" (333241)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 333241; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region_sort.bed (333250,333251,333252,333253)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 333250; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 333252; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 333251; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 333253; Command: bedtools; Return code: 0; Memory used: 0.048GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_plus_coverage.bed (334337)


Command completed. Elapsed time: 0:00:38. Running peak memory: 0.251GB.
PID: 334337; Command: bedtools; Return code: 0; Memory used: 0.016GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_minus_coverage.bed (351994)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.251GB.
PID: 351994; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR" (363004)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 363004; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR_sort.bed (363006,363007,363008,363009)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 363006; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 363007; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 363009; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 363008; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_plus_coverage.bed (363011)


Command completed. Elapsed time: 0:00:37. Running peak memory: 0.251GB.
PID: 363011; Command: bedtools; Return code: 0; Memory used: 0.017GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_minus_coverage.bed (363089)


Command completed. Elapsed time: 0:00:35. Running peak memory: 0.251GB.
PID: 363089; Command: bedtools; Return code: 0; Memory used: 0.02GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR" (363143)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.251GB.
PID: 363143; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR_sort.bed (363144,363145,363146,363147)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.251GB.
PID: 363144; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 363145; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 363147; Command: bedtools; Return code: 0; Memory used: 0.01GB
PID: 363146; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_plus_coverage.bed (363149)


Command completed. Elapsed time: 0:00:36. Running peak memory: 0.251GB.
PID: 363149; Command: bedtools; Return code: 0; Memory used: 0.03GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_minus_coverage.bed (363462)


Command completed. Elapsed time: 0:00:35. Running peak memory: 0.251GB.
PID: 363462; Command: bedtools; Return code: 0; Memory used: 0.038GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon_sort.bed (363492,363493,363494,363495)


Command completed. Elapsed time: 0:00:03. Running peak memory: 0.251GB.
PID: 363492; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 363493; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 363495; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 363494; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_plus_coverage.bed (363500)


Command completed. Elapsed time: 0:00:38. Running peak memory: 0.251GB.
PID: 363500; Command: bedtools; Return code: 0; Memory used: 0.093GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_minus_coverage.bed (363535)


Command completed. Elapsed time: 0:00:40. Running peak memory: 0.251GB.
PID: 363535; Command: bedtools; Return code: 0; Memory used: 0.043GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron_sort.bed (374569,374570,374571,374572)


Command completed. Elapsed time: 0:00:02. Running peak memory: 0.251GB.
PID: 374569; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 374571; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 374570; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 374572; Command: bedtools; Return code: 0; Memory used: 0.01GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_plus_coverage.bed (374575)


Command completed. Elapsed time: 0:00:42. Running peak memory: 0.251GB.
PID: 374575; Command: bedtools; Return code: 0; Memory used: 0.085GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_minus_coverage.bed (389599)


Command completed. Elapsed time: 0:00:40. Running peak memory: 0.251GB.
PID: 389599; Command: bedtools; Return code: 0; Memory used: 0.055GB

Plot cFRiF/FRiF (06-14 21:23:51) elapsed: 526.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_40 -z 3099922541 -n 24418925 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_plus_coverage.bed (407660)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:35. Running peak memory: 0.475GB.
PID: 407660; Command: Rscript; Return code: 0; Memory used: 0.475GB

cFRiF QC_hg38/K562_RNA-seq_40_cFRiF.pdf cFRiF QC_hg38/K562_RNA-seq_40_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_40 -z 3099922541 -n 24418925 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_Intron_plus_coverage.bed (407711)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:25. Running peak memory: 0.475GB.
PID: 407711; Command: Rscript; Return code: 0; Memory used: 0.474GB

FRiF QC_hg38/K562_RNA-seq_40_FRiF.pdf FRiF QC_hg38/K562_RNA-seq_40_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-14 21:24:54) elapsed: 63.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_exons_sort.bed (407743,407744)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.475GB.
PID: 407743; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 407744; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_introns_sort.bed (408815,408825,408826)


Command completed. Elapsed time: 0:00:05. Running peak memory: 0.475GB.
PID: 408815; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 408826; Command: bedtools; Return code: 0; Memory used: 0.004GB
PID: 408825; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_coverage.bed (411057)


Command completed. Elapsed time: 0:01:20. Running peak memory: 0.475GB.
PID: 411057; Command: bedtools; Return code: 0; Memory used: 0.096GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_coverage.bed (451940)


Command completed. Elapsed time: 0:01:18. Running peak memory: 0.475GB.
PID: 451940; Command: bedtools; Return code: 0; Memory used: 0.091GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/50.431914)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_rpkm.bed (452081,452082,452083)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.475GB.
PID: 452081; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 452083; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 452082; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/50.431914)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_rpkm.bed (452085,452086,452087)


Command completed. Elapsed time: 0:00:01. Running peak memory: 0.475GB.
PID: 452085; Command: awk; Return code: 0; Memory used: 0.007GB
PID: 452087; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 452086; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed (452090,452091,452092)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.475GB.
PID: 452090; Command: join; Return code: 0; Memory used: 0.001GB
PID: 452092; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 452091; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 3.53 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed --annotate (452098)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:04. Running peak memory: 0.475GB.
PID: 452098; Command: Rscript; Return code: 0; Memory used: 0.317GB

mRNA contamination QC_hg38/K562_RNA-seq_40_mRNA_contamination.pdf mRNA contamination QC_hg38/K562_RNA-seq_40_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/QC_hg38/K562_RNA-seq_40_exon_intron_ratios.bed (452119)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0.475GB.
PID: 452119; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-14 21:27:49) elapsed: 175.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam (452128)


Command completed. Elapsed time: 0:00:22. Running peak memory: 0.475GB.
PID: 452128; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 50431914.0 (452147)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_plus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_40_plus_cuttrace_u697j3fp'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
Discarding 109 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1']
Keeping 86 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_exact_body_0-mer.bw'
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:57. Running peak memory: 2.598GB.
PID: 452147; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.598GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam (39639)


Command completed. Elapsed time: 0:00:22. Running peak memory: 2.598GB.
PID: 39639; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 50431914.0 (39662)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/aligned_hg38/K562_RNA-seq_40_minus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_40_minus_cuttrace_9pp7snmr'
Processing with 4 cores...
stdin is empty of data
stdin is empty of data
Discarding 109 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_KI270723v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1']
Keeping 86 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270589v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_exact_body_0-mer.bw'
Merging 86 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_40/signal_hg38/K562_RNA-seq_40_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:52. Running peak memory: 2.6GB.
PID: 39662; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.6GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 0:32:36
  • Total elapsed time (all runs): 2:43:38
  • Peak memory (this run): 2.6003 GB
  • Pipeline completed time: 2020-06-14 21:44:23