Pipeline run code and environment:

  • Command: /scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name K562_RNA-seq_70 --genome hg38 --input /project/shefflab/data//guertin/fastq/K562_70pctRNA.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 0 --scale --prealignments human_rDNA --dirty -R
  • Compute host: udc-aw29-23a
  • Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc
  • Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/
  • Pipeline started at: (06-15 07:17:11) elapsed: 0.0 TIME

Version log:

  • Python version: 3.6.6
  • Pypiper dir: /sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper
  • Pypiper version: 0.12.1
  • Pipeline dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines
  • Pipeline version: 0.9.8
  • Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10
  • Pipeline branch: * master
  • Pipeline date: 2020-06-09 11:36:49 -0400
  • Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-)

Arguments passed to pipeline:

  • TSS_name: None
  • adapter: cutadapt
  • anno_name: None
  • complexity: False
  • config_file: peppro.yaml
  • cores: 12
  • coverage: False
  • dedup: seqkit
  • dirty: True
  • ensembl_gene_body: None
  • ensembl_tss: None
  • exon_name: None
  • force_follow: False
  • genome_assembly: hg38
  • input: ['/project/shefflab/data//guertin/fastq/K562_70pctRNA.fastq.gz']
  • input2: None
  • intron_name: None
  • keep: False
  • logdev: False
  • max_len: -1
  • mem: 12000
  • new_start: False
  • no_fifo: False
  • output_parent: /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline
  • paired_end: False
  • pre_name: None
  • prealignments: ['human_rDNA']
  • prioritize: False
  • protocol: PRO
  • recover: True
  • sample_name: K562_RNA-seq_70
  • scale: True
  • search_file: None
  • silent: False
  • single_or_paired: SINGLE
  • sob: False
  • testmode: False
  • trimmer: seqtk
  • umi_len: 0
  • verbosity: None

Local input file: /project/shefflab/data//guertin/fastq/K562_70pctRNA.fastq.gz

File_mb 5404.02 PEPPRO RES

Read_type SINGLE PEPPRO RES

Genome hg38 PEPPRO RES Detected PRO input

Number of input file sets: 1 Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz

ln -sf /project/shefflab/data//guertin/fastq/K562_70pctRNA.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz (13570)


Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB.
PID: 13570; Command: ln; Return code: 0; Memory used: 0.0GB

Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz' Found .fastq.gz file Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1.fastq

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1.fastq (13571)


Command completed. Elapsed time: 0:04:42. Running peak memory: 0.002GB.
PID: 13571; Command: pigz; Return code: 0; Memory used: 0.002GB

Raw_reads 70000000 PEPPRO RES

Fastq_reads 70000000 PEPPRO RES ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/K562_RNA-seq_70.fastq.gz']

FASTQ processing: (06-15 07:23:53) elapsed: 401.0 TIME

cutadapt --version Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq

(cutadapt -j 12 -m 2 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt (14198)


Command completed. Elapsed time: 0:02:56. Running peak memory: 3.999GB.
PID: 14198; Command: cutadapt; Return code: 0; Memory used: 3.999GB

seqtk trimfq -b 0 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_noadap.fastq | seqtk seq -L 2 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq (14579,14580)


Command completed. Elapsed time: 0:02:06. Running peak memory: 3.999GB.
PID: 14579; Command: seqtk; Return code: 0; Memory used: 0.001GB
PID: 14580; Command: seqtk; Return code: 0; Memory used: 0.002GB

grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{print $(NF-1)}'

Reads_with_adapter 35291630.0 PEPPRO RES

grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{print $(NF-1)}'

awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt

wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_short.fastq | awk '{print $1}'

Uninformative_adapter_reads 524857.0 PEPPRO RES

Pct_uninformative_adapter_reads 0.7498 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastqc/K562_RNA-seq_70_R1_processed_fastqc.html

echo '### Calculate the number of trimmed reads' (15064)

Calculate the number of trimmed reads

Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 15064; Command: echo; Return code: 0; Memory used: 0.0GB

Evaluating read trimming

Trimmed_reads 69475143 PEPPRO RES

Trim_loss_rate 0.75 PEPPRO RES Targetless command, running...

fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq (15098)

Started analysis of K562_RNA-seq_70_R1_processed.fastq
Approx 5% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 10% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 15% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 20% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 25% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 30% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 35% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 40% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 45% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 50% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 55% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 60% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 65% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 70% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 75% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 80% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 85% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 90% complete for K562_RNA-seq_70_R1_processed.fastq
Approx 95% complete for K562_RNA-seq_70_R1_processed.fastq
Analysis complete for K562_RNA-seq_70_R1_processed.fastq
Command completed. Elapsed time: 0:04:19. Running peak memory: 3.999GB.
PID: 15098; Command: fastqc; Return code: 0; Memory used: 0.244GB

FastQC report r1 fastqc/K562_RNA-seq_70_R1_processed_fastqc.html FastQC report r1 None PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/processed_R1.flag

touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/processed_R1.flag (15668)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 15668; Command: touch; Return code: 0; Memory used: 0.0GB

Plot adapter insertion distribution (06-15 07:35:30) elapsed: 697.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_adapter_insertion_distribution.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt (15669)

Adapter insertion distribution plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.999GB.
PID: 15669; Command: Rscript; Return code: 0; Memory used: 0.316GB

Adapter insertion distribution cutadapt/K562_RNA-seq_70_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/K562_RNA-seq_70_R1_adapter_insertion_distribution.png PEPPRO OBJ Missing stat 'Peak_adapter_insertion_size'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'

Peak_adapter_insertion_size 34 PEPPRO RES Missing stat 'Degradation_ratio'

Calculating degradation ratio (06-15 07:35:35) elapsed: 5.0 TIME

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'

awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'

awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/cutadapt/K562_RNA-seq_70_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'

Degradation_ratio 0.2308 PEPPRO RES

Prealignments (06-15 07:35:35) elapsed: 0.0 TIME

Prealignment assemblies: ['human_rDNA']

Map to human_rDNA (06-15 07:35:35) elapsed: 0.0 TIME

(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id K562_RNA-seq_70 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/fastq/K562_RNA-seq_70_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq 2>&1 > /dev/null) Missing stat 'Aligned_reads_human_rDNA' 69475143 reads; of these: 69475143 (100.00%) were unpaired; of these: 66449603 (95.65%) aligned 0 times 3025540 (4.35%) aligned exactly 1 time 0 (0.00%) aligned >1 times 4.35% overall alignment rate

Aligned_reads_human_rDNA 3025540.0 PEPPRO RES

Alignment_rate_human_rDNA 4.35 PEPPRO RES

Map to genome (06-15 07:44:33) elapsed: 538.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam

bowtie2 -p 12 --very-sensitive --rg-id K562_RNA-seq_70 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/tmpzz7s0tum -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam (16477,16483,16484)

66449603 reads; of these:
  66449603 (100.00%) were unpaired; of these:
    8296734 (12.49%) aligned 0 times
    37395744 (56.28%) aligned exactly 1 time
    20757125 (31.24%) aligned >1 times
87.51% overall alignment rate
[bam_sort_core] merging from 21 files and 1 in-memory blocks...
Command completed. Elapsed time: 0:35:47. Running peak memory: 3.999GB.
PID: 16483; Command: samtools; Return code: 0; Memory used: 0.004GB
PID: 16477; Command: bowtie2; Return code: 0; Memory used: 3.713GB
PID: 16484; Command: samtools; Return code: 0; Memory used: 0.889GB

samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam (20398)


Command completed. Elapsed time: 0:03:15. Running peak memory: 3.999GB.
PID: 20398; Command: samtools; Return code: 0; Memory used: 0.019GB

samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'

Mapped_reads 58152869 PEPPRO RES

QC_filtered_reads 10854484 PEPPRO RES

Aligned_reads 47298385 PEPPRO RES

Alignment_rate 68.08 PEPPRO RES

Total_efficiency 67.57 PEPPRO RES

Read_depth 7.29 PEPPRO RES

Compress all unmapped read files (06-15 08:41:55) elapsed: 3441.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq.gz

pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/prealignments/K562_RNA-seq_70_human_rDNA_unmap.fq (22407)


Command completed. Elapsed time: 0:02:45. Running peak memory: 3.999GB.
PID: 22407; Command: pigz; Return code: 0; Memory used: 0.009GB

Missing stat 'Mitochondrial_reads' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam.bai

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam (22566)


Command completed. Elapsed time: 0:01:12. Running peak memory: 3.999GB.
PID: 22566; Command: samtools; Return code: 0; Memory used: 0.016GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3

Mitochondrial_reads 3321940 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_noMT.bam

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam (22823)


Command completed. Elapsed time: 0:00:51. Running peak memory: 3.999GB.
PID: 22823; Command: samtools; Return code: 0; Memory used: 0.015GB

samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/chr_sizes.bed (22868,22869,22870,22871)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 22868; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 22870; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 22869; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 22871; Command: grep; Return code: 0; Memory used: 0.0GB

samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_noMT.bam (22873)


Command completed. Elapsed time: 0:00:56. Running peak memory: 3.999GB.
PID: 22873; Command: samtools; Return code: 0; Memory used: 0.019GB

mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam (22934)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 22934; Command: mv; Return code: 0; Memory used: 0.002GB

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam (22935)


Command completed. Elapsed time: 0:00:48. Running peak memory: 3.999GB.
PID: 22935; Command: samtools; Return code: 0; Memory used: 0.016GB

Missing stat 'Maximum_read_length'

samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-

Maximum_read_length 100 PEPPRO RES Missing stat 'Genome_size'

awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes

Genome_size 3099922541 PEPPRO RES

Calculate NRF, PBC1, and PBC2 (06-15 08:50:51) elapsed: 537.0 TIME

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam.bai
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv

/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv (23334)

Configured logger 'root' using pararead v0.6
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam'
Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp_K562_RNA-seq_70_sort_lm_6ny4f'
Processing with 12 cores...
Discarding 97 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1']
Keeping 98 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270583v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Command completed. Elapsed time: 0:01:04. Running peak memory: 3.999GB.
PID: 23334; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.396GB

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv

awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_bamQC.tsv

NRF 0.65 PEPPRO RES

PBC1 0.88 PEPPRO RES

PBC2 13.92 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_unmap.bam

samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_unmap.bam (23424)


Command completed. Elapsed time: 0:00:20. Running peak memory: 3.999GB.
PID: 23424; Command: samtools; Return code: 0; Memory used: 0.018GB

samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_temp.bam

Unmapped_reads 8296734 PEPPRO RES

Split BAM by strand (06-15 08:52:26) elapsed: 94.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam

samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam (23503)


Command completed. Elapsed time: 0:03:42. Running peak memory: 3.999GB.
PID: 23503; Command: samtools; Return code: 0; Memory used: 0.006GB

samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam (23880)


Command completed. Elapsed time: 0:03:37. Running peak memory: 3.999GB.
PID: 23880; Command: samtools; Return code: 0; Memory used: 0.006GB

Calculate TSS enrichment (06-15 08:59:45) elapsed: 439.0 TIME

Missing stat 'TSS_non-coding_score' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/plus_TSS.tsv,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/minus_TSS.tsv

sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed (24065)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24065; Command: sed; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt (24066)


Command completed. Elapsed time: 0:00:09. Running peak memory: 3.999GB.
PID: 24066; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.519GB

TSS_coding_score 17.7 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt

/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt (24101)


Command completed. Elapsed time: 0:00:07. Running peak memory: 3.999GB.
PID: 24101; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.581GB

TSS_non-coding_score 3.9 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSSenrichment.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt (24172)

Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_minus_TssEnrichment.txt geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' geom_smooth() using formula 'y ~ x' TSS enrichment plot completed!

Command completed. Elapsed time: 0:00:07. Running peak memory: 3.999GB.
PID: 24172; Command: Rscript; Return code: 0; Memory used: 0.204GB

TSS enrichment QC_hg38/K562_RNA-seq_70_TSSenrichment.pdf TSS enrichment QC_hg38/K562_RNA-seq_70_TSSenrichment.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt

samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt (24404,24405,24406,24407)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24404; Command: samtools; Return code: 0; Memory used: 0.0GB
PID: 24406; Command: awk; Return code: 0; Memory used: 0.0GB
PID: 24405; Command: grep; Return code: 0; Memory used: 0.0GB
PID: 24407; Command: awk; Return code: 0; Memory used: 0.0GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt (24410)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24410; Command: cut; Return code: 0; Memory used: 0.0GB

Calculate Pause Index (PI) (06-15 09:00:09) elapsed: 24.0 TIME

Missing stat 'Pause_index' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_tss.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_gene_body.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_tss.bed (24412,24413)


Command completed. Elapsed time: 0:00:02. Running peak memory: 3.999GB.
PID: 24412; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 24413; Command: bedtools; Return code: 0; Memory used: 0.093GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_gene_body.bed (24417,24418)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24417; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 24418; Command: bedtools; Return code: 0; Memory used: 0.005GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSS_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSS_density.bed (24420,24421,24422,24423)


Command completed. Elapsed time: 0:01:12. Running peak memory: 3.999GB.
PID: 24421; Command: awk; Return code: 0; Memory used: 0.001GB
PID: 24423; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 24420; Command: bedtools; Return code: 0; Memory used: 0.053GB
PID: 24422; Command: sort; Return code: 0; Memory used: 0.006GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_gene_body_density.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_gene_body_density.bed (24497,24498,24499)


Command completed. Elapsed time: 0:01:42. Running peak memory: 3.999GB.
PID: 24497; Command: bedtools; Return code: 0; Memory used: 0.244GB
PID: 24499; Command: sort; Return code: 0; Memory used: 0.005GB
PID: 24498; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed

join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm (24588,24589,24590)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24588; Command: join; Return code: 0; Memory used: 0.001GB
PID: 24590; Command: env; Return code: 0; Memory used: 0.004GB
PID: 24589; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed

awk -v OFS=' ' '{ if ($5 > 0.0384066) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/tmp43ogt6mm > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed (24596)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24596; Command: awk; Return code: 0; Memory used: 0.002GB

sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

Pause_index 7.99 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed (24601)

Pause index plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.999GB.
PID: 24601; Command: Rscript; Return code: 0; Memory used: 0.316GB

Pause index QC_hg38/K562_RNA-seq_70_pause_index.pdf Pause index QC_hg38/K562_RNA-seq_70_pause_index.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_pause_index.bed (24622)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 24622; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate Fraction of Reads in pre-mature mRNA (06-15 09:03:10) elapsed: 181.0 TIME

Missing stat 'Plus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam 47298385 18212495

Plus_FRiP 0.39 PEPPRO RES Missing stat 'Minus_FRiP'

samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam 47298385 18149986

Minus_FRiP 0.38 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_gene_coverage.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_gene_sort.bed (24740,24741)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 24740; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 24741; Command: bedtools; Return code: 0; Memory used: 0.006GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_gene_coverage.bed (24743)


Command completed. Elapsed time: 0:01:39. Running peak memory: 3.999GB.
PID: 24743; Command: bedtools; Return code: 0; Memory used: 0.198GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed

ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed.gz (25016)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25016; Command: ln; Return code: 0; Memory used: 0.002GB

pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed (25017)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25017; Command: pigz; Return code: 0; Memory used: 0.002GB

Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 09:06:09) elapsed: 179.0 TIME

cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed | sort -u Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer

awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/raw/hg38_annotations.bed (25026)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25026; Command: awk; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed (25028,25029,25030,25031)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25028; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25029; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 25031; Command: bedtools; Return code: 0; Memory used: 0.012GB
PID: 25030; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed (25034)


Command completed. Elapsed time: 0:00:34. Running peak memory: 3.999GB.
PID: 25034; Command: bedtools; Return code: 0; Memory used: 0.028GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_minus_coverage.bed (25064)


Command completed. Elapsed time: 0:00:34. Running peak memory: 3.999GB.
PID: 25064; Command: bedtools; Return code: 0; Memory used: 0.036GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed (25096,25097,25098,25099)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25096; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25097; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 25099; Command: bedtools; Return code: 0; Memory used: 0.009GB
PID: 25098; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed (25101)


Command completed. Elapsed time: 0:00:38. Running peak memory: 3.999GB.
PID: 25101; Command: bedtools; Return code: 0; Memory used: 0.141GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_minus_coverage.bed (25134)


Command completed. Elapsed time: 0:00:36. Running peak memory: 3.999GB.
PID: 25134; Command: bedtools; Return code: 0; Memory used: 0.07GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter Flanking Region
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region" (25169)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25169; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed (25170,25171,25172,25173)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25170; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25172; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 25171; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 25173; Command: bedtools; Return code: 0; Memory used: 0.012GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed (25176)


Command completed. Elapsed time: 0:00:36. Running peak memory: 3.999GB.
PID: 25176; Command: bedtools; Return code: 0; Memory used: 0.021GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_minus_coverage.bed (25209)


Command completed. Elapsed time: 0:00:35. Running peak memory: 3.999GB.
PID: 25209; Command: bedtools; Return code: 0; Memory used: 0.051GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR" (25241)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25241; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed (25242,25243,25244,25245)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25242; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25243; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 25245; Command: bedtools; Return code: 0; Memory used: 0.03GB
PID: 25244; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed (25247)


Command completed. Elapsed time: 0:00:35. Running peak memory: 3.999GB.
PID: 25247; Command: bedtools; Return code: 0; Memory used: 0.024GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_minus_coverage.bed (25515)


Command completed. Elapsed time: 0:00:35. Running peak memory: 3.999GB.
PID: 25515; Command: bedtools; Return code: 0; Memory used: 0.029GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3' UTR
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR

mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR" (25547)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 25547; Command: mv; Return code: 0; Memory used: 0.002GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed (25548,25549,25550,25551)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25548; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25549; Command: grep; Return code: 0; Memory used: 0.003GB
PID: 25551; Command: bedtools; Return code: 0; Memory used: 0.011GB
PID: 25550; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed (25554)


Command completed. Elapsed time: 0:00:37. Running peak memory: 3.999GB.
PID: 25554; Command: bedtools; Return code: 0; Memory used: 0.045GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_minus_coverage.bed (25587)


Command completed. Elapsed time: 0:00:39. Running peak memory: 3.999GB.
PID: 25587; Command: bedtools; Return code: 0; Memory used: 0.057GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed (25620,25622,25623,25624)


Command completed. Elapsed time: 0:00:03. Running peak memory: 3.999GB.
PID: 25620; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25622; Command: grep; Return code: 0; Memory used: 0.004GB
PID: 25624; Command: bedtools; Return code: 0; Memory used: 0.158GB
PID: 25623; Command: cut; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed (25628)


Command completed. Elapsed time: 0:00:44. Running peak memory: 3.999GB.
PID: 25628; Command: bedtools; Return code: 0; Memory used: 0.177GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_minus_coverage.bed (25669)


Command completed. Elapsed time: 0:00:43. Running peak memory: 3.999GB.
PID: 25669; Command: bedtools; Return code: 0; Memory used: 0.063GB

Target exists: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron
Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed

cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed (25707,25708,25709,25710)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 25707; Command: cut; Return code: 0; Memory used: 0.0GB
PID: 25709; Command: cut; Return code: 0; Memory used: 0.001GB
PID: 25708; Command: grep; Return code: 0; Memory used: 0.002GB
PID: 25710; Command: bedtools; Return code: 0; Memory used: 0.077GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed (25713)


Command completed. Elapsed time: 0:00:41. Running peak memory: 3.999GB.
PID: 25713; Command: bedtools; Return code: 0; Memory used: 0.132GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_minus_coverage.bed

bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_minus_coverage.bed (25752)


Command completed. Elapsed time: 0:00:39. Running peak memory: 3.999GB.
PID: 25752; Command: bedtools; Return code: 0; Memory used: 0.067GB

Plot cFRiF/FRiF (06-15 09:15:05) elapsed: 537.0 TIME

samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_cFRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_70 -z 3099922541 -n 22361014 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed (25989)

Cumulative cfrif plot completed!

Command completed. Elapsed time: 0:00:38. Running peak memory: 3.999GB.
PID: 25989; Command: Rscript; Return code: 0; Memory used: 0.445GB

cFRiF QC_hg38/K562_RNA-seq_70_cFRiF.pdf cFRiF QC_hg38/K562_RNA-seq_70_cFRiF.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_FRiF.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s K562_RNA-seq_70 -z 3099922541 -n 22361014 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_Intron_plus_coverage.bed (26039)

Cumulative frif plot completed!

Command completed. Elapsed time: 0:00:28. Running peak memory: 3.999GB.
PID: 26039; Command: Rscript; Return code: 0; Memory used: 0.445GB

FRiF QC_hg38/K562_RNA-seq_70_FRiF.pdf FRiF QC_hg38/K562_RNA-seq_70_FRiF.png PEPPRO OBJ

Calculate mRNA contamination (06-15 09:16:15) elapsed: 70.0 TIME

Missing stat 'mRNA_contamination' Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_exons_sort.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_introns_sort.bed

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_exons_sort.bed (26073,26074)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.999GB.
PID: 26074; Command: bedtools; Return code: 0; Memory used: 0.087GB
PID: 26073; Command: grep; Return code: 0; Memory used: 0.004GB

grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_introns_sort.bed (26080,26081,26082)


Command completed. Elapsed time: 0:00:05. Running peak memory: 3.999GB.
PID: 26080; Command: grep; Return code: 0; Memory used: 0.005GB
PID: 26082; Command: bedtools; Return code: 0; Memory used: 0.006GB
PID: 26081; Command: bedtools; Return code: 0; Memory used: 0.033GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_coverage.bed,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_coverage.bed

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_coverage.bed (26088)


Command completed. Elapsed time: 0:01:22. Running peak memory: 3.999GB.
PID: 26088; Command: bedtools; Return code: 0; Memory used: 0.162GB

bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_coverage.bed (26160)


Command completed. Elapsed time: 0:01:22. Running peak memory: 3.999GB.
PID: 26160; Command: bedtools; Return code: 0; Memory used: 0.151GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/47.298385)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_rpkm.bed (26232,26233,26234)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 26232; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 26234; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 26233; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_rpkm.bed

awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/47.298385)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_rpkm.bed (26236,26237,26238)


Command completed. Elapsed time: 0:00:01. Running peak memory: 3.999GB.
PID: 26236; Command: awk; Return code: 0; Memory used: 0.008GB
PID: 26238; Command: sort; Return code: 0; Memory used: 0.002GB
PID: 26237; Command: awk; Return code: 0; Memory used: 0.001GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed

join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed (26241,26242,26243)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 26241; Command: join; Return code: 0; Memory used: 0.001GB
PID: 26243; Command: sort; Return code: 0; Memory used: 0.004GB
PID: 26242; Command: awk; Return code: 0; Memory used: 0.001GB

awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'

mRNA_contamination 5.92 PEPPRO RES Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_mRNA_contamination.pdf

Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed --annotate (26249)

mRNA contamination plot completed!

Command completed. Elapsed time: 0:00:05. Running peak memory: 3.999GB.
PID: 26249; Command: Rscript; Return code: 0; Memory used: 0.316GB

mRNA contamination QC_hg38/K562_RNA-seq_70_mRNA_contamination.pdf mRNA contamination QC_hg38/K562_RNA-seq_70_mRNA_contamination.png PEPPRO OBJ Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed.gz

pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/QC_hg38/K562_RNA-seq_70_exon_intron_ratios.bed (26271)


Command completed. Elapsed time: 0:00:00. Running peak memory: 3.999GB.
PID: 26271; Command: pigz; Return code: 0; Memory used: 0.003GB

Produce bigWig files (06-15 09:19:16) elapsed: 181.0 TIME

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam (26279)


Command completed. Elapsed time: 0:00:23. Running peak memory: 3.999GB.
PID: 26279; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 47298385.0 (26299)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_plus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_70_plus_cuttrace_vp0t6xfp'
Processing with 4 cores...
Discarding 108 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr5_GL000208v1_random', 'chr9_KI270717v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270738v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1']
Keeping 87 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270735v1_random', 'chr22_KI270736v1_random', 'chr22_KI270737v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270580v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 87 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_exact_body_0-mer.bw'
Merging 87 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_plus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:08:00. Running peak memory: 3.999GB.
PID: 26299; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.59GB

Target to produce: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_exact_body_0-mer.bw,/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_smooth_body_0-mer.bw

samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam (27989)


Command completed. Elapsed time: 0:00:22. Running peak memory: 3.999GB.
PID: 27989; Command: samtools; Return code: 0; Memory used: 0.01GB

/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 47298385.0 (28010)

Cutting parallel chroms in half to accommodate two tracks.
Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/aligned_hg38/K562_RNA-seq_70_minus.bam'
Temporary files will be stored in: 'tmp_K562_RNA-seq_70_minus_cuttrace_8i5_a9as'
Processing with 4 cores...
Discarding 112 chunk(s) of reads: ['chrM', 'chr1_KI270709v1_random', 'chr1_KI270710v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_KI270723v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270465v1', 'chrUn_KI270435v1', 'chrUn_KI270468v1', 'chrUn_KI270510v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270538v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270521v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270755v1', 'chrUn_KI270756v1', 'chrUn_KI270757v1']
Keeping 83 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270707v1_random', 'chr1_KI270708v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr17_KI270730v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270466v1', 'chrUn_KI270467v1', 'chrUn_KI270438v1', 'chrUn_KI270519v1', 'chrUn_KI270515v1', 'chrUn_KI270583v1', 'chrUn_KI270589v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270448v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270751v1', 'chrUn_KI270754v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']
Reduce step (merge files)...
Merging 83 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_exact_body_0-mer.bw'
Merging 83 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/K562_RNA-seq_70/signal_hg38/K562_RNA-seq_70_minus_smooth_body_0-mer.bw'
Command completed. Elapsed time: 0:07:57. Running peak memory: 3.999GB.
PID: 28010; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.608GB

Pipeline completed. Epilogue

  • Elapsed time (this run): 2:18:47
  • Total elapsed time (all runs): 2:45:24
  • Peak memory (this run): 3.9988 GB
  • Pipeline completed time: 2020-06-15 09:35:58