### Pipeline run code and environment: * Command: `/scratch/jps3dp/tools/databio//peppro/pipelines/peppro.py --sample-name Jurkat_ChRO-seq_2 --genome hg38 --input /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz --single-or-paired SINGLE -O /project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline -P 12 -M 12000 --protocol PRO --umi-len 6 --scale --prealignments human_rDNA --dirty -R` * Compute host: udc-ba25-32c0 * Working dir: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc * Outfolder: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/ * Pipeline started at: (06-15 07:17:12) elapsed: 1.0 _TIME_ ### Version log: * Python version: 3.6.6 * Pypiper dir: `/sfs/qumulo/qhome/jps3dp/.local/lib/python3.6/site-packages/pypiper` * Pypiper version: 0.12.1 * Pipeline dir: `/sfs/lustre/bahamut/scratch/jps3dp/tools/databio/peppro/pipelines` * Pipeline version: 0.9.8 * Pipeline hash: 887a9a85408962dc3ca070dc954e59a5d4d73a10 * Pipeline branch: * master * Pipeline date: 2020-06-09 11:36:49 -0400 * Pipeline diff: 40 files changed, 16413 insertions(+), 3702 deletions(-) ### Arguments passed to pipeline: * `TSS_name`: `None` * `adapter`: `cutadapt` * `anno_name`: `None` * `complexity`: `False` * `config_file`: `peppro.yaml` * `cores`: `12` * `coverage`: `False` * `dedup`: `seqkit` * `dirty`: `True` * `ensembl_gene_body`: `None` * `ensembl_tss`: `None` * `exon_name`: `None` * `force_follow`: `False` * `genome_assembly`: `hg38` * `input`: `['/project/shefflab/data//sra_fastq/SRR7616134.fastq.gz']` * `input2`: `None` * `intron_name`: `None` * `keep`: `False` * `logdev`: `False` * `max_len`: `-1` * `mem`: `12000` * `new_start`: `False` * `no_fifo`: `False` * `output_parent`: `/project/shefflab/processed//peppro/paper/6.11.2020/results_pipeline` * `paired_end`: `False` * `pre_name`: `None` * `prealignments`: `['human_rDNA']` * `prioritize`: `False` * `protocol`: `PRO` * `recover`: `True` * `sample_name`: `Jurkat_ChRO-seq_2` * `scale`: `True` * `search_file`: `None` * `silent`: `False` * `single_or_paired`: `SINGLE` * `sob`: `False` * `testmode`: `False` * `trimmer`: `seqtk` * `umi_len`: `6` * `verbosity`: `None` ---------------------------------------- Local input file: /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz > `File_mb` 1914.91 PEPPRO _RES_ > `Read_type` SINGLE PEPPRO _RES_ > `Genome` hg38 PEPPRO _RES_ Detected PRO input ### Merge/link and fastq conversion: (06-15 07:17:13) elapsed: 1.0 _TIME_ Number of input file sets: 1 Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz` > `ln -sf /project/shefflab/data//sra_fastq/SRR7616134.fastq.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz` (380685)
Command completed. Elapsed time: 0:00:00. Running peak memory: 0GB. PID: 380685; Command: ln; Return code: 0; Memory used: 0.0GB Local input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz' Found .fastq.gz file Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq` > `pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq` (380689)
Command completed. Elapsed time: 0:02:57. Running peak memory: 0.002GB. PID: 380689; Command: pigz; Return code: 0; Memory used: 0.002GB > `Raw_reads` 49841170 PEPPRO _RES_ > `Fastq_reads` 49841170 PEPPRO _RES_ ['/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/Jurkat_ChRO-seq_2.fastq.gz'] ### FASTQ processing: (06-15 07:21:39) elapsed: 266.0 _TIME_ > `cutadapt --version` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq` > `(cutadapt -j 12 -m 8 -O 1 -a TGGAATTCTCGGGTGCCAAGG /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1.fastq -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq --too-short-output /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq ) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt` (381356)
Command completed. Elapsed time: 0:02:08. Running peak memory: 3.496GB. PID: 381356; Command: cutadapt; Return code: 0; Memory used: 3.496GB > `seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq` (381610,381611)
Command completed. Elapsed time: 0:01:32. Running peak memory: 3.496GB. PID: 381610; Command: seqtk; Return code: 0; Memory used: 0.001GB PID: 381611; Command: seqtk; Return code: 0; Memory used: 0.002GB Evaluating read trimming > `Trimmed_reads` 48264585 PEPPRO _RES_ > `Trim_loss_rate` 3.16 PEPPRO _RES_ Targetless command, running... > `fastqc --noextract --outdir /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastqc /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq` (382001)
Started analysis of Jurkat_ChRO-seq_2_R1_processed.fastq Approx 5% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 10% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 15% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 20% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 25% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 30% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 35% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 40% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 45% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 50% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 55% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 60% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 65% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 70% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 75% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 80% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 85% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 90% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Approx 95% complete for Jurkat_ChRO-seq_2_R1_processed.fastq Analysis complete for Jurkat_ChRO-seq_2_R1_processed.fastq # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x00007efea9c3ba34, pid=382001, tid=0x00007efe8eff7700 # # JRE version: Java(TM) SE Runtime Environment (8.0_171-b11) (build 1.8.0_171-b11) # Java VM: Java HotSpot(TM) 64-Bit Server VM (25.171-b11 mixed mode linux-amd64 compressed oops) # Problematic frame: # V [libjvm.so+0xa35a34] NMethodSweeper::sweep_code_cache()+0x524 # # Core dump written. Default location: /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/core or core.382001 # # An error report file with more information is saved as: # /sfs/lustre/bahamut/scratch/jps3dp/tools/databio/ppqc/hs_err_pid382001.log # # If you would like to submit a bug report, please visit: # http://bugreport.java.com/bugreport/crash.jsp #Command completed. Elapsed time: 0:01:52. Running peak memory: 3.496GB. PID: 382001; Command: fastqc; Return code: -6; Memory used: 0.182GB Subprocess returned nonzero result. Check above output for details ERROR: Subprocess returned nonzero result, but pipeline is continuing because nofail=True > `FastQC report r1` fastqc/Jurkat_ChRO-seq_2_R1_processed_fastqc.html FastQC report r1 None PEPPRO _OBJ_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq` > `seqkit rmdup --threads 12 --by-seq --ignore-case -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_noadap.fastq` (382314)
[INFO][0m 5764233 duplicated records removedCommand completed. Elapsed time: 0:02:06. Running peak memory: 4.061GB. PID: 382314; Command: seqkit; Return code: 0; Memory used: 4.061GB > `seqtk trimfq -b 6 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_dedup.fastq | seqtk seq -L 8 -r - > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq` (382617,382618)
Command completed. Elapsed time: 0:01:00. Running peak memory: 4.061GB. PID: 382617; Command: seqtk; Return code: 0; Memory used: 0.001GB PID: 382618; Command: seqtk; Return code: 0; Memory used: 0.002GB > `grep 'Reads with adapters:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'` > `Reads_with_adapter` 42416468.0 PEPPRO _RES_ > `grep 'Total basepairs processed:' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{print $(NF-1)}'` > `awk '{sum+=$1*$2} END {printf "%.0f", sum}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt` > `wc -l /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_short.fastq | awk '{print $1}'` > `Uninformative_adapter_reads` 223715.0 PEPPRO _RES_ > `Duplicate_reads` 5764233.0 PEPPRO _RES_ > `Pct_uninformative_adapter_reads` 0.4489 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag` > `touch /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/processed_R1.flag` (383074)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 383074; Command: touch; Return code: 0; Memory used: 0.002GB ### Plot adapter insertion distribution (06-15 07:32:20) elapsed: 641.0 _TIME_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R cutadapt -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt -u 6` (383075)
Adapter insertion distribution plot completed!Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 383075; Command: Rscript; Return code: 0; Memory used: 0.316GB > `Adapter insertion distribution` cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.pdf Adapter insertion distribution cutadapt/Jurkat_ChRO-seq_2_R1_adapter_insertion_distribution.png PEPPRO _OBJ_ Missing stat 'Peak_adapter_insertion_size' > `awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk 'BEGIN{max= 0; max_len=0; len=0}{if ($2>0+max) {max=$2; len=$1}; max_len=$1} END{print max_len-len}'` > `Peak_adapter_insertion_size` 39 PEPPRO _RES_ Missing stat 'Degradation_ratio' ### Calculating degradation ratio (06-15 07:32:24) elapsed: 5.0 _TIME_ > `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 10) {status = 1}} END {if (status) {print status} else {print 0}}'` > `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 20) {status = 1}} END {if (status) {print status} else {print 0}}'` > `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 30) {status = 1}} END {if (status) {print status} else {print 0}}'` > `awk 'NR>2 {print prev} {prev=$0}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk '{ if ($1 == 40) {status = 1}} END {if (status) {print status} else {print 0}}'` > `awk '/count/,0' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/cutadapt/Jurkat_ChRO-seq_2_R1_cutadapt.txt | awk 'NR>2 {print prev} {prev=$0}' | awk '{if ($3/$2 < 0.01) print $1, $2}' | awk '{a[NR]=$1; b[NR]=$2; max_len=$1}{if ($1 > max_len) {max_len=$1}} END{ for (i in a) print 1+max_len-a[i], b[i]}' | sort -nk1 | awk '($1 <= 20 && $1 >= 10){degradedSum += $2}; ($1 >= 30 && $1 <= 40){intactSum += $2} END {if (intactSum < 1) {intactSum = 1} print degradedSum/intactSum}'` > `Degradation_ratio` 0.4899 PEPPRO _RES_ ### Prealignments (06-15 07:32:24) elapsed: 0.0 _TIME_ Prealignment assemblies: ['human_rDNA'] ### Map to human_rDNA (06-15 07:32:24) elapsed: 0.0 _TIME_ > `(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_processed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq 2>&1 > /dev/null)` Missing stat 'Aligned_reads_human_rDNA' 48264585 reads; of these: 48264585 (100.00%) were unpaired; of these: 44313938 (91.81%) aligned 0 times 3950647 (8.19%) aligned exactly 1 time 0 (0.00%) aligned >1 times 8.19% overall alignment rate > `Aligned_reads_human_rDNA` 3950647.0 PEPPRO _RES_ > `Alignment_rate_human_rDNA` 8.19 PEPPRO _RES_ ### Map to human_rDNA (06-15 07:37:49) elapsed: 325.0 _TIME_ > `(bowtie2 -p 12 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /project/shefflab/genomes/human_rDNA/bowtie2_index/default/human_rDNA --rg-id Jurkat_ChRO-seq_2 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/fastq/Jurkat_ChRO-seq_2_R1_trimmed.fastq --un /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq 2>&1 > /dev/null)` ### Map to genome (06-15 07:42:21) elapsed: 272.0 _TIME_ No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` > `bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam` (384181,384182,384183)
44313938 reads; of these: 44313938 (100.00%) were unpaired; of these: 2435871 (5.50%) aligned 0 times 29426081 (66.40%) aligned exactly 1 time 12451986 (28.10%) aligned >1 times 94.50% overall alignment rate [bam_sort_core] merging from 12 files and 1 in-memory blocks...Command completed. Elapsed time: 0:17:27. Running peak memory: 4.061GB. PID: 384181; Command: bowtie2; Return code: 0; Memory used: 3.689GB PID: 384182; Command: samtools; Return code: 0; Memory used: 0.004GB PID: 384183; Command: samtools; Return code: 0; Memory used: 0.898GB > `samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (385717)
Command completed. Elapsed time: 0:01:10. Running peak memory: 4.061GB. PID: 385717; Command: samtools; Return code: 0; Memory used: 0.018GB > `samtools depth -b /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | awk '{counter++;sum+=$3}END{print sum/counter}'` > `Mapped_reads` 41878067 PEPPRO _RES_ > `QC_filtered_reads` 7874013 PEPPRO _RES_ > `Aligned_reads` 34004054 PEPPRO _RES_ > `Alignment_rate` 70.45 PEPPRO _RES_ > `Total_efficiency` 68.22 PEPPRO _RES_ > `Read_depth` 4.27 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` > `bowtie2 -p 12 --very-sensitive --rg-id Jurkat_ChRO-seq_2 -x /project/shefflab/genomes/hg38/bowtie2_index/default/hg38 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap_dups.fq | samtools view -bS - -@ 1 | samtools sort - -@ 1 -T /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/tmp5k9crw_4 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam` (387215,387216,387217)
39606611 reads; of these: 39606611 (100.00%) were unpaired; of these: 2278810 (5.75%) aligned 0 times 26411590 (66.68%) aligned exactly 1 time 10916211 (27.56%) aligned >1 times 94.25% overall alignment rate [bam_sort_core] merging from 11 files and 1 in-memory blocks...Command completed. Elapsed time: 0:14:27. Running peak memory: 4.061GB. PID: 387215; Command: bowtie2; Return code: 0; Memory used: 3.69GB PID: 387216; Command: samtools; Return code: 0; Memory used: 0.004GB PID: 387217; Command: samtools; Return code: 0; Memory used: 0.898GB > `samtools view -q 10 -b -@ 12 -U /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_fail_qc_dups.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (389084)
Command completed. Elapsed time: 0:01:04. Running peak memory: 4.061GB. PID: 389084; Command: samtools; Return code: 0; Memory used: 0.018GB ### Compress all unmapped read files (06-15 08:28:56) elapsed: 2794.0 _TIME_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq.gz` > `pigz -f -p 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/prealignments/Jurkat_ChRO-seq_2_human_rDNA_unmap.fq` (389153)
Command completed. Elapsed time: 0:00:55. Running peak memory: 4.061GB. PID: 389153; Command: pigz; Return code: 0; Memory used: 0.013GB Missing stat 'Mitochondrial_reads' Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam.bai` > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam` (389213)
Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB. PID: 389213; Command: samtools; Return code: 0; Memory used: 0.011GB > `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3` > `Mitochondrial_reads` 18250 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam` > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389520)
Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB. PID: 389520; Command: samtools; Return code: 0; Memory used: 0.012GB > `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | cut -f 1-2 | awk '{print $1, 0, $2}' | grep -vwe 'chrM' -vwe 'chrMT' -vwe 'M' -vwe 'MT' -vwe 'rCRSd' -vwe 'rCRSd_3k' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed` (389540,389541,389542,389543)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 389541; Command: cut; Return code: 0; Memory used: 0.0GB PID: 389543; Command: grep; Return code: 0; Memory used: 0.0GB PID: 389540; Command: samtools; Return code: 0; Memory used: 0.01GB PID: 389542; Command: awk; Return code: 0; Memory used: 0.0GB > `samtools view -L /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/chr_sizes.bed -b -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam` (389545)
Command completed. Elapsed time: 0:00:31. Running peak memory: 4.061GB. PID: 389545; Command: samtools; Return code: 0; Memory used: 0.018GB > `mv /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_noMT.bam /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389588)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 389588; Command: mv; Return code: 0; Memory used: 0.001GB > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam` (389589)
Command completed. Elapsed time: 0:00:24. Running peak memory: 4.061GB. PID: 389589; Command: samtools; Return code: 0; Memory used: 0.012GB Missing stat 'Maximum_read_length' > `samtools stats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep '^SN' | cut -f 2- | grep 'maximum length:' | cut -f 2-` > `Maximum_read_length` 70 PEPPRO _RES_ Missing stat 'Genome_size' > `awk '{sum+=$2} END {printf "%.0f", sum}' /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes` > `Genome_size` 3099922541 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam.bai` > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam` (389692)
Command completed. Elapsed time: 0:00:27. Running peak memory: 4.061GB. PID: 389692; Command: samtools; Return code: 0; Memory used: 0.013GB > `samtools idxstats /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp_dups.bam | grep -we 'chrM' -we 'chrMT' -we 'M' -we 'MT' -we 'rCRSd' -we 'rCRSd_3k'| cut -f 3` Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` No files match cleanup pattern: /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam.bai ### Calculate library complexity (06-15 08:33:38) elapsed: 282.0 _TIME_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt` > `preseq c_curve -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_out.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (389719)
BAM_INPUT TOTAL READS = 30468400 COUNTS_SUM = 30468400 DISTINCT READS = 1.6294e+07 DISTINCT COUNTS = 1118 MAX COUNT = 6926 COUNTS OF 1 = 1.31032e+07 OBSERVED COUNTS (6927) 1 13103248 2 1726484 3 540128 4 254315 5 147467 6 96195 7 68125 8 50567 9 38638 10 30601 11 24915 12 20508 13 17467 14 14643 15 12769 16 11038 17 9701 18 8575 19 7601 20 6875 21 6210 22 5518 23 5088 24 4592 25 4188 26 3754 27 3445 28 3289 29 3024 30 2717 31 2588 32 2388 33 2274 34 2083 35 1899 36 1954 37 1666 38 1757 39 1529 40 1529 41 1388 42 1291 43 1263 44 1190 45 1148 46 1044 47 1022 48 1000 49 892 50 889 51 866 52 835 53 786 54 762 55 698 56 720 57 663 58 663 59 576 60 563 61 564 62 562 63 446 64 491 65 459 66 481 67 422 68 461 69 374 70 387 71 407 72 394 73 365 74 388 75 349 76 317 77 319 78 327 79 317 80 292 81 306 82 282 83 283 84 271 85 249 86 243 87 263 88 248 89 234 90 226 91 209 92 214 93 208 94 191 95 187 96 197 97 195 98 194 99 182 100 187 101 170 102 173 103 179 104 162 105 134 106 142 107 138 108 143 109 124 110 141 111 156 112 146 113 122 114 126 115 121 116 124 117 113 118 117 119 121 120 107 121 116 122 129 123 104 124 107 125 103 126 94 127 90 128 79 129 94 130 103 131 94 132 97 133 92 134 78 135 84 136 98 137 73 138 78 139 73 140 76 141 82 142 77 143 62 144 71 145 84 146 65 147 79 148 62 149 69 150 73 151 63 152 65 153 64 154 59 155 62 156 65 157 56 158 60 159 46 160 60 161 50 162 47 163 55 164 47 165 41 166 54 167 55 168 49 169 49 170 48 171 50 172 64 173 52 174 36 175 56 176 42 177 45 178 42 179 40 180 37 181 32 182 57 183 46 184 41 185 39 186 43 187 37 188 37 189 35 190 32 191 37 192 48 193 31 194 31 195 36 196 34 197 32 198 32 199 32 200 37 201 35 202 31 203 30 204 22 205 38 206 32 207 34 208 27 209 15 210 22 211 18 212 29 213 32 214 30 215 33 216 32 217 36 218 17 219 20 220 23 221 19 222 36 223 22 224 26 225 28 226 25 227 26 228 28 229 18 230 23 231 29 232 24 233 20 234 28 235 30 236 23 237 14 238 19 239 16 240 10 241 9 242 22 243 29 244 17 245 18 246 11 247 17 248 23 249 15 250 19 251 13 252 16 253 28 254 20 255 14 256 16 257 11 258 14 259 13 260 9 261 16 262 15 263 14 264 16 265 15 266 12 267 17 268 17 269 20 270 11 271 15 272 17 273 12 274 15 275 15 276 29 277 15 278 14 279 22 280 11 281 13 282 19 283 9 284 15 285 17 286 9 287 16 288 16 289 10 290 8 291 15 292 10 293 8 294 10 295 14 296 11 297 12 298 14 299 3 300 14 301 12 302 12 303 14 304 5 305 18 306 10 307 9 308 8 309 16 310 13 311 16 312 10 313 11 314 14 315 11 316 16 317 7 318 9 319 10 320 10 321 7 322 6 323 9 324 10 325 11 326 10 327 12 328 16 329 6 330 8 331 6 332 10 333 7 334 9 335 7 336 10 337 5 338 8 339 5 340 5 341 5 342 6 343 6 344 9 345 3 346 13 347 11 348 2 349 5 350 10 351 7 352 6 353 6 354 6 355 6 356 8 357 9 358 8 359 9 360 2 361 6 362 7 363 6 364 2 365 2 366 5 367 6 368 6 369 7 370 4 371 3 372 3 373 10 374 8 375 7 376 5 377 4 378 5 379 3 380 6 381 3 382 4 383 6 384 4 385 1 386 5 387 3 388 5 389 8 390 3 391 5 392 3 393 5 394 2 395 7 396 3 397 6 398 7 399 3 400 3 401 3 402 5 403 3 404 7 405 6 406 1 407 7 408 7 409 6 410 5 411 7 412 2 413 6 414 9 415 3 416 3 417 4 418 5 419 3 420 6 421 1 422 4 423 5 424 7 425 4 426 5 427 7 428 4 429 7 430 6 431 11 432 7 433 3 434 5 435 7 436 4 437 3 438 6 439 4 440 2 441 5 442 6 443 5 444 3 445 3 446 3 447 5 448 4 449 7 450 2 451 5 452 3 453 6 454 2 455 4 456 5 457 8 458 4 459 5 460 3 461 3 462 1 463 4 464 3 465 4 466 1 467 2 468 6 469 4 470 4 471 3 472 3 473 4 474 2 475 2 476 4 477 1 478 6 479 4 480 1 481 5 482 1 483 4 484 2 486 4 487 2 488 5 489 4 490 6 491 3 492 5 493 8 494 2 495 3 496 1 497 2 498 5 499 1 500 4 501 6 502 4 503 1 504 1 505 4 506 4 507 1 508 4 509 2 510 3 511 2 513 6 514 2 515 2 516 6 517 7 518 2 519 3 520 1 521 6 522 2 523 5 524 1 525 2 526 2 527 2 528 1 529 3 530 2 531 2 532 1 533 4 534 8 535 1 536 2 537 4 538 2 539 2 540 1 541 1 542 1 543 1 544 2 545 3 546 1 547 2 548 4 549 2 550 1 552 2 553 3 554 3 555 3 556 5 557 4 558 2 559 4 561 3 562 4 563 1 564 4 567 3 569 2 570 2 571 1 572 3 573 1 574 6 575 3 576 2 577 2 578 2 579 1 580 4 581 4 582 3 583 1 584 3 585 3 586 1 587 2 588 2 589 2 590 1 591 3 592 1 593 2 594 6 595 4 596 6 597 3 598 2 599 2 601 5 603 2 604 5 605 2 606 2 607 3 608 2 609 5 610 1 611 2 612 2 613 4 616 1 617 2 618 1 619 1 620 2 621 2 622 1 623 1 624 3 625 5 626 1 627 2 628 4 630 1 631 2 632 2 633 4 635 4 636 3 637 2 638 2 639 4 640 3 641 1 642 2 644 1 645 4 646 4 647 2 648 1 649 2 650 2 651 2 652 3 653 2 654 4 655 1 656 2 657 1 658 2 659 3 660 1 661 5 662 1 663 3 664 3 665 1 666 2 667 1 668 1 671 1 672 2 673 1 674 1 675 1 677 2 678 2 679 3 680 1 682 4 684 2 685 1 686 1 687 1 688 2 689 1 690 1 691 1 694 4 695 2 696 2 697 1 699 2 700 2 702 1 703 1 704 1 705 1 706 1 707 1 712 1 713 3 714 1 715 1 716 2 717 1 718 1 719 2 720 2 721 3 722 2 723 1 724 2 725 1 729 1 730 1 731 1 732 3 733 2 735 1 736 2 737 1 738 1 739 1 741 1 744 3 746 2 747 1 748 1 749 1 750 1 751 1 752 1 753 2 754 1 755 1 756 1 760 1 761 1 763 3 764 1 765 1 766 1 767 1 768 2 770 3 771 4 772 1 774 1 775 1 777 1 778 1 779 1 780 2 782 1 784 2 789 1 790 1 792 2 793 4 794 1 797 1 800 1 802 2 803 1 804 1 806 2 807 1 808 3 809 2 810 3 811 3 813 1 814 1 815 1 816 1 817 1 818 2 819 1 820 1 821 1 822 1 823 1 824 3 828 1 829 2 832 1 835 3 836 1 837 2 838 1 840 1 844 1 847 2 849 1 850 1 852 1 854 3 858 1 859 2 861 1 862 1 863 3 864 1 866 1 867 2 869 2 871 1 872 1 873 2 876 4 878 2 880 1 882 2 885 2 886 1 887 1 889 1 890 1 891 1 892 1 895 2 897 1 898 2 899 1 902 2 903 1 905 2 907 2 909 2 910 1 911 1 912 1 917 1 918 1 921 1 922 2 923 2 927 2 928 1 930 1 932 1 937 1 939 1 940 1 944 1 945 1 947 1 951 2 952 1 953 2 956 2 959 1 961 1 963 1 964 2 965 2 967 1 970 1 971 1 981 2 982 2 984 2 985 1 986 1 989 1 990 1 992 1 993 2 994 1 995 1 996 1 997 1 998 1 1000 2 1002 1 1003 1 1004 2 1005 1 1012 1 1013 1 1017 1 1021 2 1022 1 1025 1 1027 1 1030 1 1031 2 1033 2 1034 1 1036 1 1037 1 1038 2 1040 1 1041 1 1046 1 1051 1 1053 1 1056 1 1058 1 1061 1 1062 1 1063 2 1065 1 1067 1 1069 2 1070 1 1072 1 1073 1 1074 1 1075 1 1077 1 1079 1 1082 1 1083 1 1084 2 1086 1 1093 1 1095 2 1096 1 1099 1 1101 1 1109 1 1110 1 1115 1 1122 1 1124 2 1125 1 1127 1 1130 1 1132 1 1139 2 1140 2 1142 1 1143 1 1149 1 1151 1 1153 2 1156 1 1158 1 1162 1 1163 1 1164 1 1167 2 1168 1 1170 1 1177 1 1180 1 1183 1 1185 1 1189 2 1200 1 1202 1 1203 1 1204 1 1206 1 1212 2 1215 1 1216 1 1217 2 1218 1 1219 1 1224 1 1225 1 1228 1 1231 1 1238 1 1243 1 1246 1 1249 1 1259 1 1264 1 1269 2 1274 1 1283 1 1284 1 1286 1 1288 1 1289 1 1295 1 1305 1 1313 1 1317 1 1319 1 1326 1 1328 1 1341 1 1345 1 1350 1 1351 1 1354 2 1359 1 1365 1 1371 1 1375 1 1386 1 1388 1 1394 1 1422 1 1426 1 1427 1 1433 1 1435 1 1438 1 1439 1 1445 1 1452 1 1456 2 1462 1 1465 1 1472 1 1476 1 1478 1 1485 1 1486 1 1487 1 1492 1 1493 1 1499 1 1516 1 1533 1 1535 1 1536 1 1549 1 1550 1 1556 1 1558 1 1569 1 1588 2 1609 1 1629 1 1630 1 1644 2 1649 1 1652 1 1660 1 1686 2 1689 1 1692 1 1703 1 1712 1 1713 1 1719 1 1727 1 1730 1 1738 1 1741 1 1757 1 1759 1 1762 1 1772 1 1792 1 1824 1 1831 1 1833 1 1847 1 1855 1 1870 1 1878 1 1880 1 1900 1 1920 1 1924 1 1927 1 1934 2 1941 1 1970 1 1977 1 1987 1 1991 1 1999 1 2013 1 2016 1 2034 1 2036 1 2046 1 2047 1 2050 1 2054 1 2072 1 2076 1 2103 1 2108 1 2152 1 2154 1 2173 1 2176 1 2184 1 2186 1 2188 1 2236 1 2273 1 2282 1 2296 1 2414 1 2417 1 2443 1 2489 1 2548 1 2558 1 2570 2 2586 1 2590 1 2676 1 2690 1 2697 2 2714 1 2732 1 2736 1 2859 1 2900 1 2906 1 2935 1 2941 1 2965 1 2969 1 3049 1 3104 1 3109 1 3177 1 3432 1 3478 1 3536 1 3644 1 3663 1 4052 1 4500 1 4782 1 5341 1 5798 1 5871 1 5948 1 6559 1 6926 1 sample size: 1000000 sample size: 2000000 sample size: 3000000 sample size: 4000000 sample size: 5000000 sample size: 6000000 sample size: 7000000 sample size: 8000000 sample size: 9000000 sample size: 10000000 sample size: 11000000 sample size: 12000000 sample size: 13000000 sample size: 14000000 sample size: 15000000 sample size: 16000000 sample size: 17000000 sample size: 18000000 sample size: 19000000 sample size: 20000000 sample size: 21000000 sample size: 22000000 sample size: 23000000 sample size: 24000000 sample size: 25000000 sample size: 26000000 sample size: 27000000 sample size: 28000000 sample size: 29000000 sample size: 30000000Command completed. Elapsed time: 0:02:54. Running peak memory: 4.061GB. PID: 389719; Command: preseq; Return code: 0; Memory used: 0.005GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt` > `preseq lc_extrap -v -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -B /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam` (390092)
BAM_INPUT TOTAL READS = 30468400 DISTINCT READS = 1.6294e+07 DISTINCT COUNTS = 1118 MAX COUNT = 6926 COUNTS OF 1 = 1.31032e+07 MAX TERMS = 100 OBSERVED COUNTS (6927) 1 13103248 2 1726484 3 540128 4 254315 5 147467 6 96195 7 68125 8 50567 9 38638 10 30601 11 24915 12 20508 13 17467 14 14643 15 12769 16 11038 17 9701 18 8575 19 7601 20 6875 21 6210 22 5518 23 5088 24 4592 25 4188 26 3754 27 3445 28 3289 29 3024 30 2717 31 2588 32 2388 33 2274 34 2083 35 1899 36 1954 37 1666 38 1757 39 1529 40 1529 41 1388 42 1291 43 1263 44 1190 45 1148 46 1044 47 1022 48 1000 49 892 50 889 51 866 52 835 53 786 54 762 55 698 56 720 57 663 58 663 59 576 60 563 61 564 62 562 63 446 64 491 65 459 66 481 67 422 68 461 69 374 70 387 71 407 72 394 73 365 74 388 75 349 76 317 77 319 78 327 79 317 80 292 81 306 82 282 83 283 84 271 85 249 86 243 87 263 88 248 89 234 90 226 91 209 92 214 93 208 94 191 95 187 96 197 97 195 98 194 99 182 100 187 101 170 102 173 103 179 104 162 105 134 106 142 107 138 108 143 109 124 110 141 111 156 112 146 113 122 114 126 115 121 116 124 117 113 118 117 119 121 120 107 121 116 122 129 123 104 124 107 125 103 126 94 127 90 128 79 129 94 130 103 131 94 132 97 133 92 134 78 135 84 136 98 137 73 138 78 139 73 140 76 141 82 142 77 143 62 144 71 145 84 146 65 147 79 148 62 149 69 150 73 151 63 152 65 153 64 154 59 155 62 156 65 157 56 158 60 159 46 160 60 161 50 162 47 163 55 164 47 165 41 166 54 167 55 168 49 169 49 170 48 171 50 172 64 173 52 174 36 175 56 176 42 177 45 178 42 179 40 180 37 181 32 182 57 183 46 184 41 185 39 186 43 187 37 188 37 189 35 190 32 191 37 192 48 193 31 194 31 195 36 196 34 197 32 198 32 199 32 200 37 201 35 202 31 203 30 204 22 205 38 206 32 207 34 208 27 209 15 210 22 211 18 212 29 213 32 214 30 215 33 216 32 217 36 218 17 219 20 220 23 221 19 222 36 223 22 224 26 225 28 226 25 227 26 228 28 229 18 230 23 231 29 232 24 233 20 234 28 235 30 236 23 237 14 238 19 239 16 240 10 241 9 242 22 243 29 244 17 245 18 246 11 247 17 248 23 249 15 250 19 251 13 252 16 253 28 254 20 255 14 256 16 257 11 258 14 259 13 260 9 261 16 262 15 263 14 264 16 265 15 266 12 267 17 268 17 269 20 270 11 271 15 272 17 273 12 274 15 275 15 276 29 277 15 278 14 279 22 280 11 281 13 282 19 283 9 284 15 285 17 286 9 287 16 288 16 289 10 290 8 291 15 292 10 293 8 294 10 295 14 296 11 297 12 298 14 299 3 300 14 301 12 302 12 303 14 304 5 305 18 306 10 307 9 308 8 309 16 310 13 311 16 312 10 313 11 314 14 315 11 316 16 317 7 318 9 319 10 320 10 321 7 322 6 323 9 324 10 325 11 326 10 327 12 328 16 329 6 330 8 331 6 332 10 333 7 334 9 335 7 336 10 337 5 338 8 339 5 340 5 341 5 342 6 343 6 344 9 345 3 346 13 347 11 348 2 349 5 350 10 351 7 352 6 353 6 354 6 355 6 356 8 357 9 358 8 359 9 360 2 361 6 362 7 363 6 364 2 365 2 366 5 367 6 368 6 369 7 370 4 371 3 372 3 373 10 374 8 375 7 376 5 377 4 378 5 379 3 380 6 381 3 382 4 383 6 384 4 385 1 386 5 387 3 388 5 389 8 390 3 391 5 392 3 393 5 394 2 395 7 396 3 397 6 398 7 399 3 400 3 401 3 402 5 403 3 404 7 405 6 406 1 407 7 408 7 409 6 410 5 411 7 412 2 413 6 414 9 415 3 416 3 417 4 418 5 419 3 420 6 421 1 422 4 423 5 424 7 425 4 426 5 427 7 428 4 429 7 430 6 431 11 432 7 433 3 434 5 435 7 436 4 437 3 438 6 439 4 440 2 441 5 442 6 443 5 444 3 445 3 446 3 447 5 448 4 449 7 450 2 451 5 452 3 453 6 454 2 455 4 456 5 457 8 458 4 459 5 460 3 461 3 462 1 463 4 464 3 465 4 466 1 467 2 468 6 469 4 470 4 471 3 472 3 473 4 474 2 475 2 476 4 477 1 478 6 479 4 480 1 481 5 482 1 483 4 484 2 486 4 487 2 488 5 489 4 490 6 491 3 492 5 493 8 494 2 495 3 496 1 497 2 498 5 499 1 500 4 501 6 502 4 503 1 504 1 505 4 506 4 507 1 508 4 509 2 510 3 511 2 513 6 514 2 515 2 516 6 517 7 518 2 519 3 520 1 521 6 522 2 523 5 524 1 525 2 526 2 527 2 528 1 529 3 530 2 531 2 532 1 533 4 534 8 535 1 536 2 537 4 538 2 539 2 540 1 541 1 542 1 543 1 544 2 545 3 546 1 547 2 548 4 549 2 550 1 552 2 553 3 554 3 555 3 556 5 557 4 558 2 559 4 561 3 562 4 563 1 564 4 567 3 569 2 570 2 571 1 572 3 573 1 574 6 575 3 576 2 577 2 578 2 579 1 580 4 581 4 582 3 583 1 584 3 585 3 586 1 587 2 588 2 589 2 590 1 591 3 592 1 593 2 594 6 595 4 596 6 597 3 598 2 599 2 601 5 603 2 604 5 605 2 606 2 607 3 608 2 609 5 610 1 611 2 612 2 613 4 616 1 617 2 618 1 619 1 620 2 621 2 622 1 623 1 624 3 625 5 626 1 627 2 628 4 630 1 631 2 632 2 633 4 635 4 636 3 637 2 638 2 639 4 640 3 641 1 642 2 644 1 645 4 646 4 647 2 648 1 649 2 650 2 651 2 652 3 653 2 654 4 655 1 656 2 657 1 658 2 659 3 660 1 661 5 662 1 663 3 664 3 665 1 666 2 667 1 668 1 671 1 672 2 673 1 674 1 675 1 677 2 678 2 679 3 680 1 682 4 684 2 685 1 686 1 687 1 688 2 689 1 690 1 691 1 694 4 695 2 696 2 697 1 699 2 700 2 702 1 703 1 704 1 705 1 706 1 707 1 712 1 713 3 714 1 715 1 716 2 717 1 718 1 719 2 720 2 721 3 722 2 723 1 724 2 725 1 729 1 730 1 731 1 732 3 733 2 735 1 736 2 737 1 738 1 739 1 741 1 744 3 746 2 747 1 748 1 749 1 750 1 751 1 752 1 753 2 754 1 755 1 756 1 760 1 761 1 763 3 764 1 765 1 766 1 767 1 768 2 770 3 771 4 772 1 774 1 775 1 777 1 778 1 779 1 780 2 782 1 784 2 789 1 790 1 792 2 793 4 794 1 797 1 800 1 802 2 803 1 804 1 806 2 807 1 808 3 809 2 810 3 811 3 813 1 814 1 815 1 816 1 817 1 818 2 819 1 820 1 821 1 822 1 823 1 824 3 828 1 829 2 832 1 835 3 836 1 837 2 838 1 840 1 844 1 847 2 849 1 850 1 852 1 854 3 858 1 859 2 861 1 862 1 863 3 864 1 866 1 867 2 869 2 871 1 872 1 873 2 876 4 878 2 880 1 882 2 885 2 886 1 887 1 889 1 890 1 891 1 892 1 895 2 897 1 898 2 899 1 902 2 903 1 905 2 907 2 909 2 910 1 911 1 912 1 917 1 918 1 921 1 922 2 923 2 927 2 928 1 930 1 932 1 937 1 939 1 940 1 944 1 945 1 947 1 951 2 952 1 953 2 956 2 959 1 961 1 963 1 964 2 965 2 967 1 970 1 971 1 981 2 982 2 984 2 985 1 986 1 989 1 990 1 992 1 993 2 994 1 995 1 996 1 997 1 998 1 1000 2 1002 1 1003 1 1004 2 1005 1 1012 1 1013 1 1017 1 1021 2 1022 1 1025 1 1027 1 1030 1 1031 2 1033 2 1034 1 1036 1 1037 1 1038 2 1040 1 1041 1 1046 1 1051 1 1053 1 1056 1 1058 1 1061 1 1062 1 1063 2 1065 1 1067 1 1069 2 1070 1 1072 1 1073 1 1074 1 1075 1 1077 1 1079 1 1082 1 1083 1 1084 2 1086 1 1093 1 1095 2 1096 1 1099 1 1101 1 1109 1 1110 1 1115 1 1122 1 1124 2 1125 1 1127 1 1130 1 1132 1 1139 2 1140 2 1142 1 1143 1 1149 1 1151 1 1153 2 1156 1 1158 1 1162 1 1163 1 1164 1 1167 2 1168 1 1170 1 1177 1 1180 1 1183 1 1185 1 1189 2 1200 1 1202 1 1203 1 1204 1 1206 1 1212 2 1215 1 1216 1 1217 2 1218 1 1219 1 1224 1 1225 1 1228 1 1231 1 1238 1 1243 1 1246 1 1249 1 1259 1 1264 1 1269 2 1274 1 1283 1 1284 1 1286 1 1288 1 1289 1 1295 1 1305 1 1313 1 1317 1 1319 1 1326 1 1328 1 1341 1 1345 1 1350 1 1351 1 1354 2 1359 1 1365 1 1371 1 1375 1 1386 1 1388 1 1394 1 1422 1 1426 1 1427 1 1433 1 1435 1 1438 1 1439 1 1445 1 1452 1 1456 2 1462 1 1465 1 1472 1 1476 1 1478 1 1485 1 1486 1 1487 1 1492 1 1493 1 1499 1 1516 1 1533 1 1535 1 1536 1 1549 1 1550 1 1556 1 1558 1 1569 1 1588 2 1609 1 1629 1 1630 1 1644 2 1649 1 1652 1 1660 1 1686 2 1689 1 1692 1 1703 1 1712 1 1713 1 1719 1 1727 1 1730 1 1738 1 1741 1 1757 1 1759 1 1762 1 1772 1 1792 1 1824 1 1831 1 1833 1 1847 1 1855 1 1870 1 1878 1 1880 1 1900 1 1920 1 1924 1 1927 1 1934 2 1941 1 1970 1 1977 1 1987 1 1991 1 1999 1 2013 1 2016 1 2034 1 2036 1 2046 1 2047 1 2050 1 2054 1 2072 1 2076 1 2103 1 2108 1 2152 1 2154 1 2173 1 2176 1 2184 1 2186 1 2188 1 2236 1 2273 1 2282 1 2296 1 2414 1 2417 1 2443 1 2489 1 2548 1 2558 1 2570 2 2586 1 2590 1 2676 1 2690 1 2697 2 2714 1 2732 1 2736 1 2859 1 2900 1 2906 1 2935 1 2941 1 2965 1 2969 1 3049 1 3104 1 3109 1 3177 1 3432 1 3478 1 3536 1 3644 1 3663 1 4052 1 4500 1 4782 1 5341 1 5798 1 5871 1 5948 1 6559 1 6926 1 [ESTIMATING YIELD CURVE] [BOOTSTRAPPING HISTOGRAM] ..__......................................................................................._........... [COMPUTING CONFIDENCE INTERVALS] [WRITING OUTPUT]Command completed. Elapsed time: 0:02:57. Running peak memory: 4.061GB. PID: 390092; Command: preseq; Return code: 0; Memory used: 0.005GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt` > `echo '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort_dups.bam)' '$(samtools view -c -F 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam) > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt` (390311)
Command completed. Elapsed time: 0:00:42. Running peak memory: 4.061GB. PID: 390311; Command: echo; Return code: 0; Memory used: 0.006GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R preseq -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt -r /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_counts.txt -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_plot` (390629)
Processing Jurkat_ChRO-seq_2 INFO: Found real counts for Jurkat_ChRO-seq_2 - Total (M): 33.989659 Unique (M): 30.4684 Library complexity plot completed!Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 390629; Command: Rscript; Return code: 0; Memory used: 0.286GB > `Library complexity` QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.pdf Library complexity QC_hg38/Jurkat_ChRO-seq_2_preseq_plot.png PEPPRO _OBJ_ Missing stat 'Frac_exp_unique_at_10M' > `grep -w '10000000' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_preseq_yield.txt | awk '{print $2}'` > `Frac_exp_unique_at_10M` 0.646 PEPPRO _RES_ ### Calculate NRF, PBC1, and PBC2 (06-15 08:40:15) elapsed: 397.0 _TIME_ Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam.bai` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` > `/scratch/jps3dp/tools/databio//peppro/tools/bamQC.py --silent -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -c 12 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` (390651)
Configured logger 'root' using pararead v0.6 Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam' Temporary files will be stored in: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmp_Jurkat_ChRO-seq_2_sort_2eb60nhd' Processing with 12 cores... Discarding 98 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1'] Keeping 97 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_GL000194v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270591v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV']Command completed. Elapsed time: 0:00:39. Running peak memory: 4.061GB. PID: 390651; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamQC.py; Return code: 0; Memory used: 1.617GB > `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "NRF") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` > `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC1") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` > `awk '{ for (i=1; i<=NF; ++i) { if ($i ~ "PBC2") c=i } getline; print $c }' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_bamQC.tsv` > `NRF` 0.53 PEPPRO _RES_ > `PBC1` 0.8 PEPPRO _RES_ > `PBC2` 8.39 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam` > `samtools view -b -@ 12 -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_unmap.bam` (390713)
Command completed. Elapsed time: 0:00:09. Running peak memory: 4.061GB. PID: 390713; Command: samtools; Return code: 0; Memory used: 0.009GB > `samtools view -c -f 4 -@ 12 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_temp.bam` > `Unmapped_reads` 2435871 PEPPRO _RES_ ### Split BAM by strand (06-15 08:41:10) elapsed: 55.0 _TIME_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` > `samtools view -bh -F 20 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` (390797)
Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB. PID: 390797; Command: samtools; Return code: 0; Memory used: 0.006GB > `samtools view -bh -f 16 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` (390917)
Command completed. Elapsed time: 0:01:42. Running peak memory: 4.061GB. PID: 390917; Command: samtools; Return code: 0; Memory used: 0.006GB ### Calculate TSS enrichment (06-15 08:44:34) elapsed: 204.0 _TIME_ Missing stat 'TSS_non-coding_score' Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv` > `sed -n -e '/[[:space:]]+/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv' -e '/[[:space:]]-/w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv' /project/shefflab/genomes/hg38/refgene_anno/default/hg38_TSS.bed` (391064)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391064; Command: sed; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt` > `/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/plus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt` (391065)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB. PID: 391065; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.553GB > `TSS_coding_score` 68.4 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt` > `/scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/minus_TSS.tsv -p ends -c 12 -z -v -s 6 -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt` (391102)
Command completed. Elapsed time: 0:00:10. Running peak memory: 4.061GB. PID: 391102; Command: /scratch/jps3dp/tools/databio//peppro/tools/pyTssEnrichment.py; Return code: 0; Memory used: 0.548GB > `TSS_non-coding_score` 23.2 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R tss -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt` (391139)
Generating TSS plot with /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_plus_TssEnrichment.txt and /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_minus_TssEnrichment.txt `geom_smooth()` using formula 'y ~ x' `geom_smooth()` using formula 'y ~ x' `geom_smooth()` using formula 'y ~ x' `geom_smooth()` using formula 'y ~ x' TSS enrichment plot completed!Command completed. Elapsed time: 0:00:06. Running peak memory: 4.061GB. PID: 391139; Command: Rscript; Return code: 0; Memory used: 0.316GB > `TSS enrichment` QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.pdf TSS enrichment QC_hg38/Jurkat_ChRO-seq_2_TSSenrichment.png PEPPRO _OBJ_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt` > `samtools view -H /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam | grep 'SN:' | awk -F':' '{print $2,$3}' | awk -F' ' -v OFS=' ' '{print $1,$3}' > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt` (391385,391386,391387,391388)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391385; Command: samtools; Return code: 0; Memory used: 0.0GB PID: 391387; Command: awk; Return code: 0; Memory used: 0.0GB PID: 391386; Command: grep; Return code: 0; Memory used: 0.0GB PID: 391388; Command: awk; Return code: 0; Memory used: 0.0GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt` (391390)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391390; Command: cut; Return code: 0; Memory used: 0.0GB ### Calculate Pause Index (PI) (06-15 08:45:03) elapsed: 29.0 _TIME_ Missing stat 'Pause_index' Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed` > `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_TSS.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed` (391393,391394)
Command completed. Elapsed time: 0:00:02. Running peak memory: 4.061GB. PID: 391393; Command: grep; Return code: 0; Memory used: 0.004GB PID: 391394; Command: bedtools; Return code: 0; Memory used: 0.099GB > `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/ensembl_gtf/default/hg38_ensembl_gene_body.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed` (391399,391400)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391399; Command: grep; Return code: 0; Memory used: 0.003GB PID: 391400; Command: bedtools; Return code: 0; Memory used: 0.005GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed` > `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_tss.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4,4 -k7,7nr | sort -k4,4 -u > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed` (391402,391403,391404,391405)
Command completed. Elapsed time: 0:00:46. Running peak memory: 4.061GB. PID: 391405; Command: sort; Return code: 0; Memory used: 0.002GB PID: 391402; Command: bedtools; Return code: 0; Memory used: 0.029GB PID: 391404; Command: sort; Return code: 0; Memory used: 0.012GB PID: 391403; Command: awk; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed` > `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_ensembl_gene_body.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | awk '$7>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed` (391448,391449,391450)
Command completed. Elapsed time: 0:00:58. Running peak memory: 4.061GB. PID: 391448; Command: bedtools; Return code: 0; Memory used: 0.099GB PID: 391450; Command: sort; Return code: 0; Memory used: 0.009GB PID: 391449; Command: awk; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` > `join --nocheck-order -j4 -o 1.1 1.2 1.3 1.4 1.6 1.7 2.2 2.3 2.7 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_TSS_density.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_gene_body_density.bed | awk -v OFS=' ' '{ if ($5 == "+"){print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($8-$2)^2))^2), ($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5} else {print $1, $2, $8, $4, sqrt((($6+$9)/sqrt(($3-$7)^2))^2),($6/sqrt(($3-$2)^2))/($9/sqrt(($8-$7)^2)), $5}}' | env LC_COLLATE=C sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v` (391500,391501,391502)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391500; Command: join; Return code: 0; Memory used: 0.001GB PID: 391502; Command: env; Return code: 0; Memory used: 0.004GB PID: 391501; Command: awk; Return code: 0; Memory used: 0.001GB > `awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v | sort -n | awk 'BEGIN{i=0} {s[i]=$1; i++;} END{print s[int(NR*0.5-0.5)]}'` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` > `awk -v OFS=' ' '{ if ($5 > 0.0241981) {print $1, $2, $3, $4, $6, $7}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/tmpys_vse4v > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391509)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391509; Command: awk; Return code: 0; Memory used: 0.002GB > `sort -k5,5n /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed | awk ' { a[i++]=$5; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'` > `Pause_index` 85.85 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R pi --annotate -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391514)
Pause index plot completed!Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 391514; Command: Rscript; Return code: 0; Memory used: 0.318GB > `Pause index` QC_hg38/Jurkat_ChRO-seq_2_pause_index.pdf Pause index QC_hg38/Jurkat_ChRO-seq_2_pause_index.png PEPPRO _OBJ_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed.gz` > `pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_pause_index.bed` (391535)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391535; Command: pigz; Return code: 0; Memory used: 0.004GB ### Calculate Fraction of Reads in pre-mature mRNA (06-15 08:46:55) elapsed: 112.0 _TIME_ Missing stat 'Plus_FRiP' > `samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` 34004054 12298505 > `Plus_FRiP` 0.36 PEPPRO _RES_ Missing stat 'Minus_FRiP' > `samtools view -@ 4 -c -L /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` 34004054 11929067 > `Minus_FRiP` 0.35 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed` > `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_pre-mRNA.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed` (391688,391689)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 391688; Command: grep; Return code: 0; Memory used: 0.004GB PID: 391689; Command: bedtools; Return code: 0; Memory used: 0.006GB > `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_gene_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_gene_coverage.bed` (391691)
Command completed. Elapsed time: 0:00:59. Running peak memory: 4.061GB. PID: 391691; Command: bedtools; Return code: 0; Memory used: 0.1GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed` > `ln -sf /project/shefflab/genomes/hg38/feat_annotation/default/hg38_annotations.bed.gz /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz` (391745)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391745; Command: ln; Return code: 0; Memory used: 0.002GB > `pigz -f -p 12 -d -c /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed.gz > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed` (391746)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391746; Command: pigz; Return code: 0; Memory used: 0.002GB ### Calculate cumulative and terminal fraction of reads in features (cFRiF/FRiF) (06-15 08:48:56) elapsed: 121.0 _TIME_ > `cut -f 4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed | sort -u` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer` > `awk -F' ' '{print>"/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/"$4}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/raw/hg38_annotations.bed` (391754)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 391754; Command: awk; Return code: 0; Memory used: 0.002GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed` (391756,391757,391758,391759)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 391756; Command: cut; Return code: 0; Memory used: 0.0GB PID: 391757; Command: grep; Return code: 0; Memory used: 0.002GB PID: 391759; Command: bedtools; Return code: 0; Memory used: 0.012GB PID: 391758; Command: cut; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed` (391762)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 391762; Command: bedtools; Return code: 0; Memory used: 0.008GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Enhancer_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_minus_coverage.bed` (391857)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 391857; Command: bedtools; Return code: 0; Memory used: 0.009GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed` (391890,391891,391892,391893)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 391890; Command: cut; Return code: 0; Memory used: 0.0GB PID: 391891; Command: grep; Return code: 0; Memory used: 0.003GB PID: 391893; Command: bedtools; Return code: 0; Memory used: 0.009GB PID: 391892; Command: cut; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed` (391895)
Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB. PID: 391895; Command: bedtools; Return code: 0; Memory used: 0.056GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_minus_coverage.bed` (391998)
Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB. PID: 391998; Command: bedtools; Return code: 0; Memory used: 0.047GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region` > `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter Flanking Region" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region"` (392261)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 392261; Command: mv; Return code: 0; Memory used: 0.0GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed` (392262,392263,392264,392265)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 392262; Command: cut; Return code: 0; Memory used: 0.0GB PID: 392264; Command: cut; Return code: 0; Memory used: 0.001GB PID: 392263; Command: grep; Return code: 0; Memory used: 0.002GB PID: 392265; Command: bedtools; Return code: 0; Memory used: 0.012GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed` (392268)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 392268; Command: bedtools; Return code: 0; Memory used: 0.011GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Promoter_Flanking_Region_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_minus_coverage.bed` (392304)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 392304; Command: bedtools; Return code: 0; Memory used: 0.019GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR` > `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR"` (392339)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 392339; Command: mv; Return code: 0; Memory used: 0.0GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed` (392340,392341,392342,392343)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 392340; Command: cut; Return code: 0; Memory used: 0.0GB PID: 392341; Command: grep; Return code: 0; Memory used: 0.003GB PID: 392343; Command: bedtools; Return code: 0; Memory used: 0.01GB PID: 392342; Command: cut; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed` (392345)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB. PID: 392345; Command: bedtools; Return code: 0; Memory used: 0.036GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/5_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_minus_coverage.bed` (392379)
Command completed. Elapsed time: 0:00:21. Running peak memory: 4.061GB. PID: 392379; Command: bedtools; Return code: 0; Memory used: 0.029GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR` > `mv "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3' UTR" "/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR"` (392415)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 392415; Command: mv; Return code: 0; Memory used: 0.0GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed` (392416,392417,392418,392419)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 392416; Command: cut; Return code: 0; Memory used: 0.0GB PID: 392417; Command: grep; Return code: 0; Memory used: 0.003GB PID: 392419; Command: bedtools; Return code: 0; Memory used: 0.036GB PID: 392418; Command: cut; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed` (392422)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 392422; Command: bedtools; Return code: 0; Memory used: 0.015GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/3_UTR_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_minus_coverage.bed` (392448)
Command completed. Elapsed time: 0:00:19. Running peak memory: 4.061GB. PID: 392448; Command: bedtools; Return code: 0; Memory used: 0.017GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed` (392494,392495,392496,392497)
Command completed. Elapsed time: 0:00:03. Running peak memory: 4.061GB. PID: 392494; Command: cut; Return code: 0; Memory used: 0.0GB PID: 392495; Command: grep; Return code: 0; Memory used: 0.003GB PID: 392497; Command: bedtools; Return code: 0; Memory used: 0.173GB PID: 392496; Command: cut; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed` (392502)
Command completed. Elapsed time: 0:00:25. Running peak memory: 4.061GB. PID: 392502; Command: bedtools; Return code: 0; Memory used: 0.064GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Exon_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_minus_coverage.bed` (392524)
Command completed. Elapsed time: 0:00:23. Running peak memory: 4.061GB. PID: 392524; Command: bedtools; Return code: 0; Memory used: 0.036GB Target exists: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed` > `cut -f 1 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | grep -wf - /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron | cut -f 1-3 | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed` (392560,392561,392562,392563)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 392560; Command: cut; Return code: 0; Memory used: 0.0GB PID: 392562; Command: cut; Return code: 0; Memory used: 0.001GB PID: 392561; Command: grep; Return code: 0; Memory used: 0.002GB PID: 392563; Command: bedtools; Return code: 0; Memory used: 0.083GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392566)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB. PID: 392566; Command: bedtools; Return code: 0; Memory used: 0.068GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed` > `bedtools coverage -sorted -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Intron_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_minus_coverage.bed` (392597)
Command completed. Elapsed time: 0:00:22. Running peak memory: 4.061GB. PID: 392597; Command: bedtools; Return code: 0; Memory used: 0.072GB ### Plot cFRiF/FRiF (06-15 08:54:07) elapsed: 311.0 _TIME_ > `samtools view -@ 12 -q 10 -c -F4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y cfrif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392635)
Cumulative cfrif plot completed!Command completed. Elapsed time: 0:00:36. Running peak memory: 4.061GB. PID: 392635; Command: Rscript; Return code: 0; Memory used: 0.467GB > `cFRiF` QC_hg38/Jurkat_ChRO-seq_2_cFRiF.pdf cFRiF QC_hg38/Jurkat_ChRO-seq_2_cFRiF.png PEPPRO _OBJ_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R frif -s Jurkat_ChRO-seq_2 -z 3099922541 -n 17068847 -y frif --reads -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf --bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Enhancer_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Promoter_Flanking_Region_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_5_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_3_UTR_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Exon_plus_coverage.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_Intron_plus_coverage.bed` (392790)
Cumulative frif plot completed!Command completed. Elapsed time: 0:00:26. Running peak memory: 4.061GB. PID: 392790; Command: Rscript; Return code: 0; Memory used: 0.469GB > `FRiF` QC_hg38/Jurkat_ChRO-seq_2_FRiF.pdf FRiF QC_hg38/Jurkat_ChRO-seq_2_FRiF.png PEPPRO _OBJ_ ### Calculate mRNA contamination (06-15 08:55:11) elapsed: 64.0 _TIME_ Missing stat 'mRNA_contamination' Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed` > `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_exons.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed` (393034,393035)
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 393035; Command: bedtools; Return code: 0; Memory used: 0.097GB PID: 393034; Command: grep; Return code: 0; Memory used: 0.004GB > `grep -wf /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_keep.txt /project/shefflab/genomes/hg38/refgene_anno/default/hg38_introns.bed | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt | bedtools sort -i stdin -faidx /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed` (393080,393081,393082)
Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 393080; Command: grep; Return code: 0; Memory used: 0.005GB PID: 393082; Command: bedtools; Return code: 0; Memory used: 0.003GB PID: 393081; Command: bedtools; Return code: 0; Memory used: 0.037GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed` > `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_exons_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed` (393089)
Command completed. Elapsed time: 0:00:38. Running peak memory: 4.061GB. PID: 393089; Command: bedtools; Return code: 0; Memory used: 0.032GB > `bedtools coverage -sorted -counts -s -a /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/hg38_introns_sort.bed -b /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_sort.bam -g /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/chr_order.txt > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed` (393166)
Command completed. Elapsed time: 0:00:43. Running peak memory: 4.061GB. PID: 393166; Command: bedtools; Return code: 0; Memory used: 0.059GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed` > `awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed` (393768,393769,393770)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 393768; Command: awk; Return code: 0; Memory used: 0.008GB PID: 393770; Command: sort; Return code: 0; Memory used: 0.006GB PID: 393769; Command: awk; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed` > `awk -v OFS=' ' '{chrom[$4] = $1; if($4!=prev4) {chromStart[$4] = $2} strand[$4] = $6; readCount[$4] += $7; exonCount[$4] += 1; geneSizeKB[$4] += (sqrt(($3-$2+0.00000001)^2)/1000); gene[$4] = $4; chromEnd[$4]=$3; prev4=$4} END { for (a in readCount) { print chrom[a], chromStart[a], chromEnd[a], gene[a], (readCount[a]/34.004054)/geneSizeKB[a], strand[a]}}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_coverage.bed | awk '$5>0' | sort -k4 > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed` (393773,393774,393775)
Command completed. Elapsed time: 0:00:01. Running peak memory: 4.061GB. PID: 393773; Command: awk; Return code: 0; Memory used: 0.008GB PID: 393775; Command: sort; Return code: 0; Memory used: 0.004GB PID: 393774; Command: awk; Return code: 0; Memory used: 0.001GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed` > `join --nocheck-order -a1 -a2 -j4 /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_introns_rpkm.bed /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exons_rpkm.bed | awk -v OFS=' ' 'NF==11 {print $7, $8, $9, $1, ($10/$5), $11}' | sort -k1,1 -k2,2n > /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed` (393777,393778,393779)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 393777; Command: join; Return code: 0; Memory used: 0.001GB PID: 393779; Command: sort; Return code: 0; Memory used: 0.004GB PID: 393778; Command: awk; Return code: 0; Memory used: 0.001GB > `awk '{print $5}' /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed | sort -n | awk ' { a[i++]=$1; } END { x=int((i+1)/2); if (x < (i+1)/2) print (a[x-1]+a[x])/2; else print a[x-1]; }'` > `mRNA_contamination` 1.2 PEPPRO _RES_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf` > `Rscript /scratch/jps3dp/tools/databio//peppro/tools/PEPPRO.R mrna -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed --annotate` (393786)
mRNA contamination plot completed!Command completed. Elapsed time: 0:00:05. Running peak memory: 4.061GB. PID: 393786; Command: Rscript; Return code: 0; Memory used: 0.316GB > `mRNA contamination` QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.pdf mRNA contamination QC_hg38/Jurkat_ChRO-seq_2_mRNA_contamination.png PEPPRO _OBJ_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed.gz` > `pigz -f -p 12 -f /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/QC_hg38/Jurkat_ChRO-seq_2_exon_intron_ratios.bed` (393816)
Command completed. Elapsed time: 0:00:00. Running peak memory: 4.061GB. PID: 393816; Command: pigz; Return code: 0; Memory used: 0.005GB ### Produce bigWig files (06-15 08:56:48) elapsed: 98.0 _TIME_ Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw` > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam` (393824)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB. PID: 393824; Command: samtools; Return code: 0; Memory used: 0.007GB > `/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0` (393843)
Cutting parallel chroms in half to accommodate two tracks. Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_plus.bam' Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_plus_cuttrace_ywx6rsj8' Processing with 4 cores... stdin is empty of data stdin is empty of data stdin is empty of data Discarding 114 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr3_GL000221v1_random', 'chr9_KI270717v1_random', 'chr9_KI270718v1_random', 'chr14_GL000194v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr17_KI270730v1_random', 'chr22_KI270732v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270522v1', 'chrUn_KI270511v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270580v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270593v1', 'chrUn_KI270330v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270366v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270741v1', 'chrUn_GL000226v1', 'chrUn_KI270747v1', 'chrUn_KI270749v1', 'chrUn_KI270750v1', 'chrUn_KI270753v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2'] Keeping 81 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270719v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_KI270722v1_random', 'chr14_KI270725v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270518v1', 'chrUn_KI270512v1', 'chrUn_KI270519v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270583v1', 'chrUn_KI270587v1', 'chrUn_KI270591v1', 'chrUn_KI270521v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_GL000213v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270746v1', 'chrUn_KI270748v1', 'chrUn_KI270751v1', 'chrUn_KI270752v1', 'chrUn_KI270754v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_GL000218v1', 'chrEBV'] Reduce step (merge files)... Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_exact_body_0-mer.bw' Merging 81 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_plus_smooth_body_0-mer.bw'Command completed. Elapsed time: 0:07:41. Running peak memory: 4.061GB. PID: 393843; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.705GB Target to produce: `/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw`,`/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw` > `samtools index /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam` (396260)
Command completed. Elapsed time: 0:00:12. Running peak memory: 4.061GB. PID: 396260; Command: samtools; Return code: 0; Memory used: 0.007GB > `/scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py -i /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam -c /project/shefflab/genomes/hg38/fasta/default/hg38.chrom.sizes -o /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw -w /project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw -p 8 --variable-step --tail-edge --scale 34004054.0` (396271)
Cutting parallel chroms in half to accommodate two tracks. Registering input file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/aligned_hg38/Jurkat_ChRO-seq_2_minus.bam' Temporary files will be stored in: 'tmp_Jurkat_ChRO-seq_2_minus_cuttrace_43w60_dz' Processing with 4 cores... stdin is empty of data Discarding 111 chunk(s) of reads: ['chrM', 'chr1_KI270707v1_random', 'chr1_KI270709v1_random', 'chr2_KI270715v1_random', 'chr2_KI270716v1_random', 'chr9_KI270717v1_random', 'chr9_KI270719v1_random', 'chr14_KI270722v1_random', 'chr14_KI270723v1_random', 'chr14_KI270724v1_random', 'chr14_KI270725v1_random', 'chr17_KI270730v1_random', 'chr22_KI270735v1_random', 'chr22_KI270737v1_random', 'chr22_KI270739v1_random', 'chrY_KI270740v1_random', 'chrUn_KI270302v1', 'chrUn_KI270304v1', 'chrUn_KI270303v1', 'chrUn_KI270305v1', 'chrUn_KI270322v1', 'chrUn_KI270320v1', 'chrUn_KI270310v1', 'chrUn_KI270316v1', 'chrUn_KI270315v1', 'chrUn_KI270312v1', 'chrUn_KI270311v1', 'chrUn_KI270317v1', 'chrUn_KI270412v1', 'chrUn_KI270411v1', 'chrUn_KI270414v1', 'chrUn_KI270419v1', 'chrUn_KI270418v1', 'chrUn_KI270420v1', 'chrUn_KI270424v1', 'chrUn_KI270417v1', 'chrUn_KI270422v1', 'chrUn_KI270423v1', 'chrUn_KI270425v1', 'chrUn_KI270429v1', 'chrUn_KI270466v1', 'chrUn_KI270465v1', 'chrUn_KI270468v1', 'chrUn_KI270509v1', 'chrUn_KI270518v1', 'chrUn_KI270508v1', 'chrUn_KI270516v1', 'chrUn_KI270512v1', 'chrUn_KI270522v1', 'chrUn_KI270515v1', 'chrUn_KI270517v1', 'chrUn_KI270529v1', 'chrUn_KI270528v1', 'chrUn_KI270530v1', 'chrUn_KI270539v1', 'chrUn_KI270544v1', 'chrUn_KI270548v1', 'chrUn_KI270583v1', 'chrUn_KI270581v1', 'chrUn_KI270579v1', 'chrUn_KI270589v1', 'chrUn_KI270593v1', 'chrUn_KI270591v1', 'chrUn_KI270329v1', 'chrUn_KI270334v1', 'chrUn_KI270333v1', 'chrUn_KI270335v1', 'chrUn_KI270338v1', 'chrUn_KI270340v1', 'chrUn_KI270336v1', 'chrUn_KI270337v1', 'chrUn_KI270363v1', 'chrUn_KI270364v1', 'chrUn_KI270362v1', 'chrUn_KI270378v1', 'chrUn_KI270379v1', 'chrUn_KI270389v1', 'chrUn_KI270390v1', 'chrUn_KI270387v1', 'chrUn_KI270395v1', 'chrUn_KI270396v1', 'chrUn_KI270388v1', 'chrUn_KI270394v1', 'chrUn_KI270386v1', 'chrUn_KI270391v1', 'chrUn_KI270383v1', 'chrUn_KI270393v1', 'chrUn_KI270384v1', 'chrUn_KI270392v1', 'chrUn_KI270381v1', 'chrUn_KI270385v1', 'chrUn_KI270382v1', 'chrUn_KI270376v1', 'chrUn_KI270374v1', 'chrUn_KI270372v1', 'chrUn_KI270373v1', 'chrUn_KI270375v1', 'chrUn_KI270371v1', 'chrUn_KI270448v1', 'chrUn_KI270521v1', 'chrUn_GL000226v1', 'chrUn_GL000213v1', 'chrUn_KI270746v1', 'chrUn_KI270747v1', 'chrUn_KI270748v1', 'chrUn_KI270750v1', 'chrUn_KI270752v1', 'chrUn_KI270753v1', 'chrUn_KI270754v1', 'chrUn_KI270756v1', 'chrUn_GL000214v1'] Keeping 84 chunk(s) of reads: ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chr20', 'chr21', 'chr22', 'chrX', 'chrY', 'chr1_KI270706v1_random', 'chr1_KI270708v1_random', 'chr1_KI270710v1_random', 'chr1_KI270711v1_random', 'chr1_KI270712v1_random', 'chr1_KI270713v1_random', 'chr1_KI270714v1_random', 'chr3_GL000221v1_random', 'chr4_GL000008v2_random', 'chr5_GL000208v1_random', 'chr9_KI270718v1_random', 'chr9_KI270720v1_random', 'chr11_KI270721v1_random', 'chr14_GL000009v2_random', 'chr14_GL000225v1_random', 'chr14_GL000194v1_random', 'chr14_KI270726v1_random', 'chr15_KI270727v1_random', 'chr16_KI270728v1_random', 'chr17_GL000205v2_random', 'chr17_KI270729v1_random', 'chr22_KI270731v1_random', 'chr22_KI270732v1_random', 'chr22_KI270733v1_random', 'chr22_KI270734v1_random', 'chr22_KI270736v1_random', 'chr22_KI270738v1_random', 'chrUn_KI270442v1', 'chrUn_KI270467v1', 'chrUn_KI270435v1', 'chrUn_KI270438v1', 'chrUn_KI270510v1', 'chrUn_KI270519v1', 'chrUn_KI270511v1', 'chrUn_KI270507v1', 'chrUn_KI270538v1', 'chrUn_KI270587v1', 'chrUn_KI270580v1', 'chrUn_KI270590v1', 'chrUn_KI270584v1', 'chrUn_KI270582v1', 'chrUn_KI270588v1', 'chrUn_KI270330v1', 'chrUn_KI270366v1', 'chrUn_GL000195v1', 'chrUn_GL000219v1', 'chrUn_GL000220v1', 'chrUn_GL000224v1', 'chrUn_KI270741v1', 'chrUn_KI270743v1', 'chrUn_KI270744v1', 'chrUn_KI270745v1', 'chrUn_KI270749v1', 'chrUn_KI270751v1', 'chrUn_KI270755v1', 'chrUn_KI270757v1', 'chrUn_KI270742v1', 'chrUn_GL000216v2', 'chrUn_GL000218v1', 'chrEBV'] Reduce step (merge files)... Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_exact_body_0-mer.bw' Merging 84 files into output file: '/project/shefflab/processed/peppro/paper/6.11.2020/results_pipeline/Jurkat_ChRO-seq_2/signal_hg38/Jurkat_ChRO-seq_2_minus_smooth_body_0-mer.bw'Command completed. Elapsed time: 0:07:35. Running peak memory: 4.061GB. PID: 396271; Command: /scratch/jps3dp/tools/databio//peppro/tools/bamSitesToWig.py; Return code: 0; Memory used: 2.618GB ### Pipeline completed. Epilogue * Elapsed time (this run): 1:55:16 * Total elapsed time (all runs): 2:23:22 * Peak memory (this run): 4.0615 GB * Pipeline completed time: 2020-06-15 09:12:28