Using custom adapters

A custom adapter file can be set in the pipeline configuration file, pipelines/peppro.yaml. If left null, the default, then it uses the included adapter file.

Alternatively, you may specify a path to your own adapter file. For example: adapters: /home/userid/my_custom_adapters.fa

The only requirement here is that it expects specific headers for 5' and 3' adapters. For example:

>5prime
TGGAATTCTCGGGTGCCAAGG
>3prime
GATCGTCGGACTGTAGAACTCTGAAC

Using a custom pipeline configuration file with looper

If you want to use a custom peppro.yaml without modifying the original, specify the path via the config_file attribute in your project configuration file or sample sheet. This is passed to the pipeline as the -C argument.

Apply to all samples (project-wide)

Add config_file under sample_modifiers.append in your project config:

sample_modifiers:
  append:
    config_file: /path/to/my_peppro.yaml

Apply to individual samples

Add a config_file column to your sample sheet CSV:

sample_name,genome,protocol,read1,config_file
my_sample,hg38,PRO,/path/to/reads.fq.gz,/path/to/my_peppro.yaml